| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
a Division of Cardiac Surgery, McGill University Health Center, Montreal, Quebec, Canada
b Department of Anesthesia, McGill University Health Center, Montreal, Quebec, Canada
Accepted for publication October 8, 2007.
* Address correspondence to Dr Shum-Tim, Division of Cardiothoracic Surgery, McGill University Health Center, 1650 Cedar Ave, Suite C9-169, Montreal, Quebec, H3G 1A4, Canada (Email: dshumtim{at}yahoo.ca).
 |
Abstract |
|---|
 Top Abstract IntroductionMaterial and MethodsResultsCommentAcknowledgmentsReferences |
|---|
Methods: Immunocompetent female rats underwent coronary ligations (n = 90). In group I, lacZ-labeled male human MSCs were implanted into the peri-infarcted area. In groups II, III, and IV, isogeneic rat MSCs, culture medium, or human fibroblasts were injected, respectively. Echocardiography was carried out to assess cardiac function, and the specimens were examined serially for up to 8 weeks with immunohistochemistry, fluorescent in situ hybridization, and polymerase chain reaction to examine MSCs survival and differentiation.
Results: Human MSCs survived within the rat myocardium for more than 8 weeks without immunosuppression. Furthermore, the implanted MSCs significantly contributed to the improvement in ventricular function and attenuated left ventricular remodeling. No cellular infiltration characteristic of immune rejection was noted in contrast to group IV.
Conclusions: Human MSCs survived within this xenogeneic environment, and contributed to the improvement in cardiac function. Our findings support the feasibility of using these cells as universal donor cells for xenogeneic or allogeneic cell therapy, as they can be prepared and stored well in advance for urgent use. Allogeneic MSCs from healthy donors may be particularly useful for severely ill or elderly patients whose own MSCs could be dysfunctional.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterial and MethodsResultsCommentAcknowledgmentsReferences |
|---|
Despite the promising early results, such clinical application remains limited by the logistic, economic, and timing issues when harvesting autologous cells from elderly sick patients. Furthermore, a number of recent studies have documented a significantly reduced capacity for neovascularization, proliferation, and differentiation as well as increased levels of apoptosis in vitro and in vivo in MSCs obtained from elderly donors and from patients with diabetes or ischemic heart disease [8, 9]. These impairments clearly limit the therapeutic potential of autologous MSCs and highlight therefore the clinical advantages of universal donor cells for cellular transplantation.
Recently rodent and porcine MSCs have been reported to be uniquely immune tolerant, both in the in vitro mixed lymphocyte coculture studies [10] and in the in vivo allotransplant and xenotransplant models [11–14]. Although there is a substantive body of literature that supports the notion that human MSCs are immunosuppressive in vitro, it is not yet clearly proven whether their immunoprivileged properties are retained universally in vivo, and whether these cells still possess their ability to improve ventricular function within a xenogeneic environment. Thus we transplanted human MSCs into infarcted rat myocardium without the use of any immunosuppression and evaluated whether these cells could (1) survive, (2) differentiate, and (3) contribute to the improvement in heart function.
|
Material and Methods |
|---|
|
TopAbstractIntroductionMaterial and MethodsResultsCommentAcknowledgmentsReferences |
|---|
Experimental Design
A total of 90 female rats underwent proximal left coronary artery ligations and were randomly assigned to three groups. In group I (n = 40), lacZ-labeled human male MSCs (3 x 106) suspended in 150 µL of Dulbecco’s modified Eagle’s medium were directly injected into three different sites around the peri-ischemic area of rat myocardium 5 minutes after coronary ligation. Isogeneic rat MSCs (3 x 106) and an equivalent volume of culture medium were similarly injected after ligation into groups II and III, respectively (n = 10 each). No immunosuppression was given at any time.
Additionally, fully differentiated human male fibroblasts (3 x 106) were directly injected into infarcted rat myocardium and served as immunologic controls (group IV, n = 12).
Isolation, Culture, and Labeling of Rat and Human Marrow Stromal Cells
Rat MSC cultures were prepared according to Caplan’s method and transfected with pMFG-lacZ plasmid expressing β-galactosidase gene as described previously [15].
Human MSCs were isolated, cultured, and prepared by Cambrex Inc [16]. Briefly, bone marrow aspirates were passed through a density gradient, and hematopoietic cells, fibroblasts, and other nonadherent cells were washed away during medium changes. The remaining purified MSC population was further expanded in culture to form a clonal homogeneous population of cells, characterized by specific cell surface markers being positive for CD166, CD105, CD44, CD29, and HLA A, B, and C and negative for hematopoietic markers such as CD14, CD34, and CD45 and for HLA-DR. Furthermore, their capacity to differentiate along adipogenic, chondrogenic, and osteogenic lineages was assessed as described elsewhere [16]. They were then shipped to our laboratory at 4°C for cell transplantation. On arrival, the cells were resuspended in Dulbecco’s modified Eagle’s medium, transfected with the lacZ-encoding gene, and incubated at 37°C, pH 7.8.
Human Fibroblasts
Human fibroblasts were harvested by outgrowth from a piece of skin taken from male donors and transfected with the lacZ reporter gene as previously described [15].
Creation of the Infarction and Transplantation of Marrow Stromal Cells
Female rats were anesthetized with 5% isoflurane (MTC Pharmaceuticals, Cambridge, Ontario, Canada), intubated, and ventilated at 85 breaths/min. Anesthesia was maintained with 3% inhaled isoflurane.
A 1.5-cm left anterolateral thoracotomy was performed in the fifth intercostal space, and the left coronary artery was ligated 1 to 2 mm from its origin with a 7-0 polypropylene suture (Ethicon, Inc, Somerville, NJ). Successful performance of coronary occlusion was verified by the development of a pale color in the ventricle after ligation. Under direct vision, MSCs were injected at three different sites into the peri-infarcted area using a 28-gauge syringe. Small blebs under the injected area were confirmed in every case. After achieving hemostasis, the muscle layers and skin were closed separately. Buprenorphine hydrochloride (0.01 to 0.05 mg/kg subcutaneously) was given postoperatively, and the animals were placed in a temperature-controlled chamber until they resumed full alertness.
Functional Assessment
Transthoracic echocardiography was performed on all surviving animals in groups I (n = 23), II (n = 10), and III (n = 10) at 3 to 4 days (baseline) and at 6 to 8 weeks after ligation. Baseline measurements were also taken in group IV. Echocardiograms were obtained with a commercially available system (SonoSite, Titan-Washington, Seattle, WA) equipped with a 15-MHz transducer. We decided a priori to exclude any rat that had an ejection fraction greater than 0.45 after the first echocardiogram. After sedating the animals with 2% isoflurane, echocardiography was performed as described elsewhere [3]. Briefly, parasternal long- and short-axis views were obtained with both M-mode and two-dimensional images. End-diastolic (LVEDD) and end-systolic (LVESD) diameters were measured with M-mode tracings between the anterior and posterior walls from the short-axis view just below the level of the papillary muscles of the mitral valve. Two images on average were obtained in each view and averaged over three consecutive cardiac cycles. This was done according to the American Society of Echocardiology leading-edge method [3]. Fractional shortening was determined as [(LVEDD – LVESD) / LVEDD] x 100 (%). Left ventricular end-diastolic volume (LVEDV) was calculated as 7.0 x LVEDD3 / (2.4 + LVEDD), and left ventricular end-systolic volume (LVESV) as 7.0 x LVESD3 / (2.4 + LVESD. The ejection fraction was estimated as (LVEDV – LVESV) / LVEDV.
All measurements were performed by one experienced observer (J.F.A.), who was blinded to the treatment groups.
Tissue Processing and Staining for β-Galactosidase Activity
Hearts from group I were serially harvested at different time intervals for up to 8 weeks. Five rats were sacrificed at 1 week, 12 rats at 3 weeks, 13 rats at 6 weeks, and 10 rats at 8 weeks. All the hearts from groups II and III were processed 8 weeks after cell implantation (n = 10 each). Specimens were randomly harvested at 1, 3, 5, 8, 10, 12, and 14 days in group IV and processed for histologic analyses.
The hearts were fixed in 2% paraformaldehyde and stained for β-galactosidase activity as described previously [15]. After X-gal staining, the hearts were cut longitudinally and embedded in paraffin.
Histologic and Immunohistochemical Analyses
Sections from each specimen were stained with hematoxylin and eosin to assess cell survival and the extent of cellular infiltration. To examine the extent of differentiation, immunohistochemical staining was done as previously described [15] using cardiac-specific markers for troponin Ic (Santa-Cruz Biotechnology Inc, Santa Cruz, CA) and connexin-43 (Zymed Laboratories, Inc, San Francisco, CA). Cellular infiltration was confirmed by staining with CD68 monoclonal antibodies against macrophages (Abcam Inc, Cambridge, MA).
Furthermore, fluorescent in situ hybridization was used as previously described [17] to confirm our results by allowing the detection of DNA sequences specific to the human Y chromosome. In brief, samples were digested with a pepsin–proteinase K solution (Sigma Laboratories, St. Louis, MO) for 30 minutes at 37°C. They were then covered with 100% ethanol and incubated overnight at 42°C with 10 µL of fluorescent in situ hybridization probe mixture (CEP, Vysis Inc, Des Plaines, IL) targeting the human Y chromosome. After several washings, 10 µL of counterstain containing 4,6-diamino-2-phenylindole (Sigma Laboratories) was applied to the target area. Human male fibroblasts and female rat hearts with no MSC implantation were used as positive and negative controls respectively. Slides were all examined using an Olympus fluorescent microscope (Tokyo, Japan) by an independent blinded observer.
Polymerase Chain Reaction Analysis
Samples from groups I and IV were randomly selected for polymerase chain reaction analysis to confirm the survival of the implanted male cells into female hearts at different time intervals.
Genomic DNA was purified using DNeasy (Quiagen, Valencia, CA) according to the manufacturer’s instructions, and the presence of living human male cells in female hearts was confirmed by targeting a specific microsatellite sequence within the human Y chromosome (DYS390). The primer pairs used were TATATTTTACACATTTTTGGGCC and TGACAGTAAAATGAACACATTGC.
Statistical Analysis
All data are expressed as mean ± standard error of the mean. Repeated echocardiographic variables at 3 to 4 days and at 6 to 8 weeks were compared by means of one-way repeated-measures analysis of variance. If a significant F ratio was obtained, a Bonferroni post hoc test was used to assess pairwise differences. A probability value of less than 0.05 was considered statistically significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterial and MethodsResultsCommentAcknowledgmentsReferences |
|---|
Mortality and Sample Size
The overall mortality was 20% (18 of 90) occurring during the first 48 hours after ligation. There was no significant difference in mortality among the different groups. No late postoperative death was observed. Echocardiographic measurements were done in 43 rats, immunohistochemical analyses in 72 rats, and polymerase chain reaction in 20 rats. All rats had an ejection fraction of 0.45 or less after ligation and were all therefore included in the analyses.
Histologic and Immunohistochemical Assessment of Engrafted Cells
After X-gal staining, all hearts in groups I and II revealed distinct areas of blue discoloration, suggesting the presence of labeled cells (Fig 1). This was in contrast with the hearts in the control group. Gross examination of the infarcted hearts revealed a fibrous scar in the left ventricle that was clearly delineated from the normal myocardium (Fig 2A). As could be expected, isogeneic rat MSCs were shown to engraft within the injured rat myocardium (Fig 2C). Histologic examination of serial sections of group I confirmed the successful engraftment of human MSCs within the xenogeneic environment at 1, 3, 6, and 8 weeks after implantation (Figs 2, 3).
This finding was primarily assessed by histochemistry and confirmed by fluorescent in situ hybridization analyses (Fig 4).
|
|
|
|
Although a mild inflammatory reaction was seen as expected in all groups at an early stage, no significant inflammatory response suggestive of immune rejection remained in any cross sections of group I after 1 week, even after the expression of cardiac-specific markers. This was in contrast with group IV, in which extensive monocellular and macrophage infiltration was noted early after xenogeneic fibroblast implantation (Figs 5A–5C). This was accompanied by a rapid loss of labeled fibroblasts with time, with none remaining 8 days after ligation.
|
|
|
|
|
Comment |
|---|
|
TopAbstractIntroductionMaterial and MethodsResultsCommentAcknowledgmentsReferences |
|---|
Perhaps the most significant observation in this study was the successful engraftment and survival of human MSCs in a xenogeneic immunocompetent environment. It is important to emphasize that, clinically, we would still favor the use of allogeneic MSCs for cellular transplantation to avoid risks such as transspecies viral infections. However, we decided to confirm their immunotolerance property in an extreme model of xenogeneic mismatch, as this would be immunologically more challenging.
We previously reported the formation of stable cardiac chimera in mice-to-rat [13, 18] and pig-to-rat [14] models. However, in this current study, we used a clonally homogeneous population of human MSCs, fully characterized by specific cell surface markers and by their confirmed potential to differentiate in vitro into multiple cell lineages [16].
Reproducing our previous results using mice [13, 18] or pig MSCs [14], no significant inflammatory reaction was observed in the MSC-transplanted groups. This also confirms the in vitro findings reported by Grinnemo and colleagues [19] in which human MSCs were tolerated when cocultured with rat lymphocytes. However, this was in contrast with our immunologic control group in which human male fibroblasts were implanted. In this case, as expected, a massive monocellular infiltration was seen early after implantation and the human fibroblasts were rapidly rejected.
In this current study, we confirmed the importance of the microenvironment to supply the proper conditions for cardiomyocyte differentiation of the MSCs. These results are consistent with previous observations reported by our group [6, 15] and by other laboratories [2, 4, 7, 16]. It is of interest to note that at 3 weeks, none of the β-galactosidase–positive cells expressed cardiac-specific markers. At 6 weeks, some transplanted cells were shown to acquire a more mature elongated phenotype and to better integrate within the cardiomyocyte network. This was more apparent at 8 weeks after transplantation when some cells started to express cardiac-specific markers and to develop connexin-43–positive gap junctions with other host cardiomyocytes. Although the extent of complete differentiation was not observed in all the slides, some transplanted cells seemed to acquire with time a more mature phenotype, appearing more rod-shaped with a centrally located nuclei and aligning themselves within the muscle fibers.
Orlic and associates [2] reported that intramyocardial injection of bone marrow–derived cells led to the regeneration of greater than 60% of contracting myocardium. Similarly, after transplanting MSCs into rat myocardium, Tomita and coworkers [7] reported the expression of cardiac-specific proteins 8 weeks later. In contrast, Balsam and colleagues [20] reported fusion of implanted cells with the host cells, without evidence of donor cell differentiation. Thus, whether MSCs could fully differentiate into cardiomyocytes remains controversial. It may be noted, however, the cells used by Balsam and associates [20] were CD34-positive hematopoietic stem cells, whereas our cells are CD34-negative MSCs obtained from the marrow stroma, which characteristically adhere to the culture dish, in contrast to the hematopoietic stem cells.
Our findings also confirmed in vivo the concept that the "milieu-dependent differentiation" may not be species specific. Fukuhara and coworkers [21] had shown that coculture of mouse MSCs with rat cardiomyocytes could successfully induce the former to undergo cardiomyocyte differentiation.
Our results reported here were in contrast with those of Grinnemo and associates [19], who similarly transplanted human MSCs into infarcted rat myocardium. In their study, human MSCs could not be detected 1 week after implantation, and a massive infiltration was observed in the immunocompetent rats. However there seems to be some subtle differences in our experimental designs. For example, in their study, MSCs were harvested from the sternum of patients undergoing cardiac surgery [19]. Such patients tend to be older and sick. A number of recent studies have shown that MSCs harvested from elderly patients and from patients with coronary artery disease exhibit a lower capacity for differentiation, survival, and proliferation [8, 9]. In our study, human MSCs were collected from young healthy donors with no history of cardiac or other systemic diseases. In fact, the same group had previously demonstrated the immunotolerant properties of human MSCs in several in vitro studies [10, 22]. It is of interest to note that in all these studies, as well as in the in vitro studies by others [23], human MSCs used were harvested from young healthy donors. Further studies to clarify reasons for such contradictory findings will be highly desirable.
Our findings of immune privilege of MSCs are consistent with many recent observations made in the in vitro mixed lymphocyte coculture studies [10–12]. In addition to being hypoimmunogenic and expressing low levels of MHC antigens and costimulatory molecules, MSCs have been shown to suppress alloreactive and xenoreactive lymphoproliferative responses and to modulate T-cell and natural killer cell activity by altering the cytokine secretion profile of antigen-presenting cells [10]. The secretion of antiinflammatory cytokines may also augment the immunosuppressive effects of regulatory T cells. In addition to this in vitro evidence, there is mounting observations that MSCs are immunoprivileged cells in vivo as well. The injection of allogeneic MSCs in baboons was tolerated without immunosuppression [24] and was shown to prolong skin graft survival [11], to engraft in the brains of albino rats [25], and to reduce severe graft-versus-host disease during bone marrow allotransplantations [26]. Furthermore, Liechty and colleagues [27] reported the survival of human MSCs in fetal sheep and their differentiation along multiple lineages, even after the development of immune competence. Additionally, our group had reported previously similar results in mouse-to-rat [13, 18] and pig-to-rat [14] xenotransplant models.
In the present study, MSC transplantation was accompanied by a significant improvement in ventricular function, which was greater in the MSC-transplanted groups at all times. These results extend the previously reported findings of MSC transplantation in several other studies in animal models [3, 4, 6] and in humans [1]. Although the exact mechanism for improved heart function was not determined in this study, it has been suggested that heart function might be improved by the contractile properties of the neocardiomyocytes [2, 6], by preventing ventricular remodeling and dilatation [4], by enhancing neoangiogenesis [3, 4, 7], and through other paracrine mechanisms altering the extracellular matrix and reducing scar formation and expansion [5, 28, 29]. On the basis of the small number of cells retained after implantation and given the magnitude of the effects on ventricular function, it is likely that the improvement in regional function probably resulted from a combination of these factors, although further mechanistic studies are definitively warranted.
Our observations further suggest that, in addition to the improved contractile function, MSCs contributed as well in attenuating LV remodeling and preventing LV dilatation as demonstrated by the relative stabilization of the LV dimensions in the transplanted groups with time. This is consistent with our previous findings [6, 18] and may be related to the paracrine action of engrafted MSCs after myocardial infarction involving a number of angiogenic and growth factors, and the downregulation of proapoptotic proteins [5, 28, 29]. Although we did not detect a significant change in the cardiac function in all the groups at 3 to 4 days after implantation, it is possible that the mechanical trauma of cell injection may have transiently depressed the cardiac function, masking the beneficial effect of cell implantation that could be detected at an earlier stage.
The main limitation associated with our experimental design is the lack of precise quantitative data on cell survival and the extent of the immune response. Although we did not quantitatively assess cell survival after injection, we and others have previously demonstrated that a relatively small proportion of cells is retained after injection, mainly because of mechanical losses attributed to the injection of cells into a beating heart [30]. This important issue is under intensive study by us to improve the efficiency of cell delivery.
Although we did not assess the question of chronic rejection, we confirmed the survival of these cells for up to 6 months in a previous study implanting pig MSCs into rat myocardium [14]. Recently, a similar finding in an allogeneic model was reported also by Dai and colleagues [4]. Further studies will, however, be required to better examine the type of the immune reaction and the mechanisms of immune tolerance of MSCs, after a short and a longer follow-up. Finally, although our primary goal was to assess survival of MSCs in a xenogeneic environment, future studies using confocal microscopy and looking at the expression of other contractile proteins are highly desirable to better assess the extent of cellular differentiation.
In summary, our present study confirms the in vivo immunotolerance property of human MSCs and their contribution in improving heart function in an extreme model of xenogeneic mismatch. By attenuating contractile dysfunction and pathologic remodeling, these cells significantly contributed to a remarkable recovery in ventricular performance after myocardial infarction.
We suggest that this unique attribute would allow these cells to be used as universal donor cells with fascinating therapeutic implications. From a clinical perspective, these cells could be harvested and mass-produced well in advance, tested for their functional capabilities, and stored as a standardized cell population for immediate off-the-shelf use on any patient without delay after an acute myocardial infarction. Such logistic advantages are not available with the use of autologous MSCs that are currently the cell source of choice. Perhaps more importantly, because such allogeneic MSCs can be obtained from young healthy donors, they could be of great value in patients with genetic cardiomyopathies and in elderly patients with advanced diabetes, heart failure, or cachexia whose own MSCs could be dysfunctional.
|
Acknowledgments |
|---|
|
TopAbstractIntroductionMaterial and MethodsResultsCommentAcknowledgmentsReferences |
|---|
|
References |
|---|
|
TopAbstractIntroductionMaterial and MethodsResultsCommentAcknowledgmentsReferences |
|---|
Related Article
This article has been cited by other articles:
|
|
 |
|
  J. L. Herrmann, A. M. Abarbanell, B. R. Weil, Y. Wang, M. Wang, J. Tan, and D. R. Meldrum Cell-based therapy for ischemic heart disease: a clinical update. Ann. Thorac. Surg., November 1, 2009; 88(5): 1714 - 1722. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. L Kao, W. Browder, and C. Li Cellular Cardiomyoplasty: What Have We Learned? Asian Cardiovasc Thorac Ann, January 1, 2009; 17(1): 89 - 101. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Atoui, D. Shum-Tim, and R. C.J. Chiu Myocardial Regenerative Therapy: Immunologic Basis for the Potential "Universal Donor Cells" Ann. Thorac. Surg., July 1, 2008; 86(1): 327 - 334. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. L. Tang Invited Commentary Ann. Thorac. Surg., February 1, 2008; 85(2): 580 - 580. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ANN THORAC SURG | ASIAN CARDIOVASC THORAC ANN | EUR J CARDIOTHORAC SURG |
| J THORAC CARDIOVASC SURG | ICVTS | ALL CTSNet JOURNALS |
p < 0.05 when compared with results at 3 to 4 days after ligation. Data are represented as mean ± standard error of the mean.