ATS
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Personal Folders
Right arrow Download to citation manager
Right arrow Author home page(s):
Edward Hickey
Xiaomang You
Ross Ungerleider
Right arrow Permission Requests
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hickey, E.
Right arrow Articles by Ungerleider, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hickey, E.
Right arrow Articles by Ungerleider, R.
Related Collections
Right arrow Cerebral protection
Right arrow Extracorporeal circulation

Ann Thorac Surg 2007;83:895-901
© 2007 The Society of Thoracic Surgeons


Hawley H. Seiler Resident Award Paper

The Use of a Miniaturized Circuit and Bloodless Prime To Avoid Cerebral No-Reflow After Neonatal Cardiopulmonary Bypass

Edward Hickey, MRCSa,b,*,*, Tara Karamlou, MDa,b, Xiaomang You, MD, CCPa, Chris Komanapalli, MDa, Tom Person, MDa, Krista Wehrley, BAa, Ross Ungerleider, MDa

a Oregon Health and Sciences University, Portland, Oregon
b Hospital for Sick Children, Toronto, Ontario, Canada

Accepted for publication October 16, 2006.

* Address correspondence to Dr Hickey, CHSS Data Center 555 University Ave, Toronto, Ontario M5G 1X8, Canada (Email: edward.hickey{at}sickkids.ca).

Presented at the Basic Science Forum of the Fifty-second Annual Meeting of the Southern Thoracic Surgical Association, Orlando, FL, Nov 10–12, 2005.


The Hawley H. Seiler Resident Award is presented annually to the resident with the oral presentation and manuscript deemed the best of those submitted for competition. This Award was inaugurated in 1997 to honor Dr Seiler for his contributions and dedicated service to the Southern Thoracic Surgical Association.

 

    Abstract
 Top
 Abstract
 Introduction
 Material and Methods
 Results
 Comment
 Footnotes
 References
 
Background: Our miniaturized bloodless prime circuit for neonatal cardiopulmonary bypass (CPB) has previously been shown to elicit significantly reduced systemic inflammation. We studied the effects of this circuit on cerebral reperfusion because the pathophysiology of "no-reflow" is believed to have an inflammatory component.

Methods: Twenty neonatal piglets were randomized to CPB with miniaturized circuitry using either blood (group 1) or bloodless (group 2) prime. At 18°C, piglets underwent 60 minutes of either (A) deep hypothermic circulatory arrest (DHCA) or (B) continuous low-flow bypass (DHCLF). Analysis of cerebral blood flow (CBF) was undertaken before and after CPB in addition to quantification of circulating tumor necrosis factor-{alpha} (TNF{alpha}) and intracerebral TNF{alpha} messenger RNA (mRNA).

Results: The final hematocrit in group 2 was 22% versus 28% (p < 0.05). The CBF fell in every animal in group 1A, but increased in every animal in group 2A (p < 0.001), despite no overall change in total cardiac output. The use of DHCLF was not associated with pronounced trends in either prime group. Final serum TNF{alpha} concentrations were significantly higher in group 1B (3166 ± 843 pg/mL) than group 2B (439 ± 192 pg/mL; p < 0.05). Irrespective of the CPB strategy used, the use of a blood prime generated significantly higher levels of intracerebral TNF{alpha} mRNA.

Conclusions: We attribute the hyperemic cerebrovascular response to reduced inflammation through avoiding allogeneic whole blood. The analysis of circulating and intracerebral TNF{alpha} in this study suggests that DHCLF in conjunction with a bloodless prime might offer advantages through avoiding ischemia, no-reflow, and in addition, resulting in a significantly reduced cerebral inflammatory response.

Conventional neonatal cardiopulmonary bypass (CPB) requires the use of a blood prime to prevent unacceptable hemodilution. Severe hemodilution is a problem not only for red blood cell–dependent gas transport but also for platelet-dependent and humoral factor–dependent coagulation and protein-dependent intravascular oncotic pressure [1]. However, the use of blood in both adult and infant CPB is now being scrutinized, and early indications have confirmed that avoiding its use is associated with improved recovery [2, 3].

Periods of ischemia during deep hypothermic circulatory arrest (DHCA) have been implicated in subsequent neurologic deficit [4]. A consistent feature of DHCA in experimental models is the abnormal recovery of cerebral blood flow (CBF) after the ischemic period, a phenomenon termed "no-reflow" [5]. Methods that alleviate no-reflow are associated with improved neurologic recovery [5, 6]. No-reflow is believed to have both mechanical and physiologic components. Inflammatory debris may occlude the capillary bed [7], and an imbalance in vasoactive mediators, including endothin-1, nitric oxide, and eicosanoids, may contribute to dysfunction of cerebral autoregulation [8].

To prevent unwanted effects of ischemia, several novel strategies have been introduced, including deep hypothermic continuous low flow (DHCLF) [9]. The consequences for cerebral reperfusion after DHCLF are less well defined, but cerebrovascular abnormalities have been described to a lesser degree [10].

We aimed to examine the benefits a bloodless prime circuit may confer on cerebral recovery after deep hypothermic CPB. Because the pathophysiology of cerebral no-reflow may have an inflammatory component, and because our experimental model of bloodless prime neonatal CPB is associated with reduced systemic inflammation, we hypothesized it may also beneficially impact cerebral no-reflow. We therefore placed animals on CPB using a further miniaturized circuit primed with either whole blood or crystalloid. After exposing them to a strategy of either DHCA or DHCLF, we examined cerebral perfusion using the fluorescent microsphere technique. In addition, we examined both the systemic and local cerebral inflammatory response through the quantification of circulating tumor necrosis factor-{alpha} (TNF{alpha}) or its intracerebral messenger RNA (mRNA).


    Material and Methods
 Top
 Abstract
 Introduction
 Material and Methods
 Results
 Comment
 Footnotes
 References
 
Surgical Procedures
All animal experiments were conducted with the approval of the institution’s Animal Care and Use Committee. The animals received humane care in compliance with the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health (NIH publication 85-23, revised 1995).

Twenty neonatal piglets (2 to 5 kg) were randomized equally to two groups according to the composition of the CPB prime. Group 1 was exposed to a miniaturized circuit primed with fresh whole blood harvested from an adult donor pig on the day of surgery; group 2 was exposed to a miniaturized circuit with a modified bloodless prime. During CPB, animals within each group were randomly subdivided equally to a strategy of either DHCA (A) or DHCLF (B).

The surgical protocol was as described previously [11]. Briefly, after premedication with 8 mg/kg Telozole (Baxter Healthcare, Round Lake, IL) and anesthetic induction (0.5% isofluorane, fentanyl citrate, 25 µg/kg), surgical tracheotomy was performed to allow controlled ventilation, maintaining arterial oxygen and carbon dioxide tensions within normal limits. Rectal and esophageal temperature probes were placed for core temperature monitoring, and catheters were inserted into the right femoral artery and vein for sampling and pressure monitoring.

Through a median sternotomy, a pulmonary artery ultrasonic flow probe (Transonic Systems, Ithica, NY) was placed around the main pulmonary artery for measurement of cardiac output. A catheter was inserted into the left atrial appendage for post-CPB injection of fluorescent microspheres. After systemic heparinization, the aortic root and right atrial appendage were cannulated (DLP Inc, Grand Rapids, MI) through purse-string sutures. Normothermic CPB was established at a rate of 100 to 150 mL/(kg · min) to maintain mean arterial pressures of 50 mm Hg.

The animal was then perfusion-cooled using a pH-stat strategy over a minimum of 30 minutes until both probes had stabilized at 18°C, and the heart and head were then packed in ice. In groups 1A and 2A (DHCA), CPB was stopped and the arterial line was clamped for 60 minutes. In groups 1B and 2B (DHCLF), the pump flow was reduced to 50 mL/(kg · min) for the 60-minute period. Full-flow CPB was then reinstituted and rewarming initiated with the use of sodium bicarbonate (8.4%) as necessary. The animal was rewarmed during a minimum duration of 30 minutes, ensuring a mean arterial pressure of 50 mm Hg, and weaned from CPB. Thirty minutes after discontinuation of CPB, the animal was euthanized with 1 mL/kg phenytoin sodium (Euthasol, Baxter Healthcare).

Miniaturized Circuit
The miniaturized extracorporeal circuit included the following: a Cobe Century (Cobe Cardiovascular, Arvada, CO) roller pump console; an infant oxygenator-reservoir (Capiox-Baby RX-05, Terumo, Tokyo, Japan); Cobe tubing packs including a 3/16-inch internal diameter arterial catheter (60 cm) and a 1/4-inch venous catheter (30 cm). The pump boot was a 3/16-inch catheter (raceway 43 cm). Venous return was vacuum assisted (–20 mm Hg). A left ventricular vent was routinely inserted through an apical purse-string suture for decompression of the ventricular cavity. The prime constituents and circuit are illustrated in Figure 1. For group 1, blood was harvested from an adult donor animal under sterile conditions and general anesthetic on the day of surgery and stored at 4°C in citrate-phosphate-dextrose until used [11].


Figure 1
View larger version (93K):
[in this window]
[in a new window]

 
Fig 1. Photograph shows the experimental miniaturized circuit, and the prime constituents in each experimental group are listed.

 
Data Acquisition and Sample Preparation
Arterial blood gas, systemic and venous blood pressure, heart rate, and cardiac output measurements were obtained at baseline before CPB and again 30 minutes after the discontinuation of CPB using a computerized chart recorder (Gould Instruments, Valley View, OH). All animals were allowed to stabilize for 10 minutes before each data acquisition point.

Analysis of Cerebral Blood Flow
CBF measurements were determined by the reference-sample, fluorescent-labeled microsphere technique [12]. Briefly, suspensions of microspheres with a diameter of 15.5 ± 0.1 µm (Biopal Inc, Worcester, MA) containing approximately 5 x 106 microspheres were used for each injection. The microspheres were injected through either the sidearm of the aortic cannula (data point 1) or through the left atrial cannula (data point 2) to ensure thorough mixing of the microspheres before arrival at the aortic root. The injection was performed over 30 seconds and flushed with warm saline.

A reference blood sample was withdrawn from the distal aorta at a constant rate using a Harvard syringe pump (Harvard Apparatus, Holliston, MA) through the femoral artery. This withdrawal commenced 10 seconds before microsphere injection and continued for a total of 3 minutes.

After euthanasia, the brain was removed and cerebral hemispheres dissected. Three representative samples of cortical grey matter of approximately 2 grams each were weighed fresh and dried together with reference blood samples overnight at 70°C. Samples were subsequently analyzed to estimate the quantity of each type of fluorescent-labeled microsphere present in each sample (Biophysics Assay, Biopal Inc). The withdrawal rate of the reference blood sample and the ratio of counts from a cortical specimen to the reference blood sample allowed calculation of the cerebral blood flow.

Tumor Necrosis Factor-{alpha} Assay
An enzyme-linked immunosorbent assay (ELISA) porcine cytokine kit (R & D Systems Inc, Minneapolis, MN) was used to assay the serum concentration of TNF-{alpha} as previously described by our laboratory [11].

Analysis of Intracerebral Tumor Necrosis Factor-{alpha} Messenger RNA
Quantitative real-time polymerase chain reaction (RT-PCR) was used to determine TNF{alpha} mRNA concentrations using techniques similar to others [13]. Pairs of 20mer primers were used to amplify a 146bp region of pig GAPDH (GenBank Accession # AF017079), a 178bp region of pig 18S (GenBank Accession # AY265350.1), and a 111bp region of pig TNF{alpha}(GenBank Accession # NM_214022). Primer sequences were as follows: Pig GAPDH Fwd: TCGGCATCGTGGAAGGACTC, Rev: AGCCTTGGCAGCACCAGTAG; Pig 18S ribosomal RNA Fwd: CGGAACTGAGGCCATGATTA, Rev: TCGGAACTACGACGGTATCT; Pig TNF{alpha} Fwd: CCAATGGCAGAGTGGGTATG, Rev: TTGATCTCGGCACTGAGTCG (for RT reaction), Rev 2: AGGACCTGGGAGTAGATGAG (for PCR reaction).

Total RNA was isolated from 100-mg chunks of flash-frozen forebrain grey matter using the RNeasy Tissue Lipid Kit (Qiagen Inc, Valencia, CA). A series of dilutions were made from a single pig forebrain RNA sample, which were used to make a standard curve. A 1:25 dilution was made of each sample RNA. For each standard RNA and sample RNA, a reverse transcription reaction was performed with SuperScript II RNase-H RT (Invitrogen, Carlsbad, CA). The primers used for reverse transcription were the Pig 18S Rev, 3' phosphorylated 18S Rev, Pig GAPDH Rev, and Pig TNF{alpha} Rev primers.

PCR reactions were performed on a LightCycler Instrument (Roche Diagnostics, Indianapolis, IN), using the Quantitect SYBR Green PCR Kit (Qiagen). Fluorescence was plotted as a function of temperature to allow the determination of the specific Tm for each product. Relative quantification was undertaken as follows. For each primer pair (GAPDH fwd + rev, 18S fwd + rev, and TNFa fwd + rev), a separate PCR reaction was run for six standard curve samples, each unknown sample, and the four RT replicate samples. The threshold cycle for each standard curve sample was plotted against the log concentration of that sample. Complimentary DNA from unknown samples was diluted 1:25, and the concentration of each amplicon was calculated based on the equation derived from the standard curve. Concentrations of the TNF{alpha} mRNA were then calculated for each sample by comparison with the two housekeeping genes, GADPH and 18S.

Statistical Analysis
All data are expressed as mean ± standard error of the mean. Paired Student t tests were used to compare pre-CPB and post-CPB measurements within groups, and unpaired t tests were used to compare the two different groups within the same CPB strategy. Statistical significance was tested to the 95% confidence limit.


    Results
 Top
 Abstract
 Introduction
 Material and Methods
 Results
 Comment
 Footnotes
 References
 
Arterial Blood Gas and Hemodynamic Data
There were no significant differences between the animal groups pre-CPB. Hemodynamic and acid-base status, systemic and central venous blood pressures, heart rate, and cardiac output were all similar post-CPB, with no significant differences (Table 1). No sodium bicarbonate was administered after wean; and therefore, the similar pressures and acid-base status were a useful indicator of adequate hemodynamic function in all groups. Arterial tensions of carbon dioxide, a powerful stimulus for cerebral vasodilatation, were similar between groups at both data acquisition points.


View this table:
[in this window]
[in a new window]

 
Table 1 Indices Before and After Cardiopulmonary Bypass for Each Experimental Group a
 
Cerebral Blood Flow
CBF data for the two data acquisition points is given in Figure 2. Each animal served as its own control and therefore the change in cerebral blood flow from baseline within each animal is especially useful (Fig 3). Every animal in group 1A (blood prime DHCA) exhibited a drop in postbypass CBF (mean –44% ± 12.5% from baseline), and every animal in group 2A (bloodless prime DHCA) displayed an elevation in postbypass CBF (mean +28% ± 6.5% from baseline; p < 0.001). In both groups exposed to DHCLF (1B and 2B), the response was varied, with both increases and decreases observed in postbypass CBF. Examined as a fraction of total cardiac output, postbypass CBF was only 16.9% ± 4.4% of the overall cardiac output in group 1A, compared with 31.8% ± 4.8% in group 2A (p = 0.038; Fig 4).


Figure 2
View larger version (30K):
[in this window]
[in a new window]

 
Fig 2. Calculated cerebral blood flow before (clear bar) and after (filled bar) cardiopulmonary bypass (CPB) in the experimental groups (mL/(min · 100 g). Data are expressed as mean ± standard error of the mean; *p = 0.01 compared with corresponding group using a blood prime. (DHCA = deep hypothermic circulatory arrest; DHCLF = deep hypothermic continuous low-flow bypass.)

 

Figure 3
View larger version (17K):
[in this window]
[in a new window]

 
Fig 3. Change in cerebral blood flow from pre-cardiopulmonary bypass baseline values within each experimental group. Data are expressed as mean ± standard error of the mean; *p < 0.001 compared with corresponding group using a blood prime. (DHCA = deep hypothermic circulatory arrest; DHCLF = deep hypothermic continuous low-flow bypass.)

 

Figure 4
View larger version (23K):
[in this window]
[in a new window]

 
Fig 4. Post-bypass calculated cerebral blood flow as a percentage of total cardiac output. Data are expressed as mean ± standard error of the mean; *p = 0.04 compared with corresponding group using a blood prime. (DHCA = deep hypothermic circulatory arrest; DHCLF = deep hypothermic continuous low-flow bypass.)

 
Circulating Tumor Necrosis Factor-{alpha} Load
Circulating TNF{alpha} concentrations were significantly higher post-CPB after DHCLF with a blood prime (group 1B; 3166 ± 843 pg/mL) than DHCLF using a bloodless prime (group 2B; 439 ± 192 pg/mL; p = 0.01; Fig 5). By contrast, TNF{alpha} concentrations were similar between groups exposed to DHCA, regardless of whether blood (group 1A, 1179 ± 914 pg/mL) was used or not (group 2A, 1626 ± 852 pg/mL). Three samples of donor blood were analyzed, revealing a mean of 213 ± 89 pg/mL.


Figure 5
View larger version (21K):
[in this window]
[in a new window]

 
Fig 5. Serum tumor necrosis-{alpha} concentration (pg/mL) at the conclusion of the experiment. Data are expressed as mean ± standard error of the mean; *p = 0.01 compared with corresponding group using a blood prime. (DHCA = deep hypothermic circulatory arrest; DHCLF = deep hypothermic continuous low-flow bypass.)

 
Intracerebral Expression of Tumor Necrosis Factor-{alpha} Messenger RNA
Quantification of TNF{alpha} mRNA within sampled cerebral cortex is shown in Fig 6. After DHCLF with a blood prime (group 1B), mean TNF{alpha} mRNA levels were elevated 2.2 ± 1.0-fold or 2.2 ± 1.19-fold (GADPH and 18S RNA respectively), whereas the same strategy using a bloodless prime (group 2B) revealed only negligible levels (0.30 ± 0.1-fold and 0.29 ± 0.08-fold, respectively; p = 0.09). A similar pattern was observed after DHCA (2.3 ± 1.3 and 2.2 ± 1.2 versus 0.70 ± 0.21 and 0.64 ± 0.14; p = 0.13 and p = 0.12, respectively). Overall, irrespective of the CPB strategy, the use of blood generated significantly elevated levels of intracerebral TNF{alpha} mRNA (2.3 ± 1.11-fold and 2.1 ± 1.1-fold versus 0.5 ± .17; p = 0.03; and 0.5 ± .14-fold; p = 0.04, respectively; Fig 7).


Figure 6
View larger version (20K):
[in this window]
[in a new window]

 
Fig 6. Quantification of intra-cerebral tumor necrosis factor-{alpha} (TNF{alpha}) messenger RNA, by real-time polymerase chain reaction. Levels are expressed as relative fold increases or decreases compared with two housekeeping genes (GADPH and 18S ribosomal RNA). Data are expressed as mean ± standard error of the mean. (TNF{alpha}:GADPH, clear bar; TNF{alpha}:18S, shaded bar; GADPH:18S, square filled bar.)

 

Figure 7
View larger version (21K):
[in this window]
[in a new window]

 
Fig 7. Intracerebral tumor necrosis factor-{alpha} (TNF{alpha}) messenger RNA (mRNA) expression, regardless of deep hypothermic cardiopulmonary bypass (CPB) strategy adopted. Data are expressed as mean ± standard error of the mean; *p = 0.03 and p = 0.04 for TNF{alpha} mRNA versus GADPH (clear bar) and 18S RNA (filled bar), respectively, when compared with animals exposed to CPB using a blood prime.

 

    Comment
 Top
 Abstract
 Introduction
 Material and Methods
 Results
 Comment
 Footnotes
 References
 
The possibility of completely bloodless prime in neonatal CPB is attractive [14, 15]. Several groups have begun to describe systems for reducing or even eliminating blood use in clinical infant CPB [16–18]. Most notably, Merkle and colleagues [19] have recently described a series of infants as small as 3.4 kg placed on CPB with a crystalloid prime of 190 mL, all of whom recovered uneventfully. Our efforts have focused on reducing the prime volume by using the smallest available oxygenators, minimizing catheter length, and eliminating ancillary equipment such as filters and cardioplegia circuits. Piglets have a lower baseline hematocrit (25% to 30%) than humans, but hemodilution in this present study was limited to post-CPB levels of 22%. The threshold for an "unacceptable" hematocrit is not clearly defined, but several studies indicate that oxygen delivery, tissue blood flow, and clinical outcome are only severely affected at levels as low as 14% to 17% [20, 21].

This study examines experimental no-reflow in a neonatal model that avoids the use of donor blood. Previous studies have required large volumes of allogeneic whole blood and have repeatedly demonstrated a significant cerebral no-reflow after DHCA [22, 23]. We have instead observed here a mild hyperemic response in the early reperfusion period. The mechanisms behind these observations are unclear. The small differences in hematocrit between groups (22% versus 28%), and a corresponding fall in CBF as a proportion of total cardiac output suggest that it is unlikely to be solely due to hemodilution necessarily resulting from a bloodless prime. In fact, other groups have studied the influence of hemodilution and report significant elevations in CBF only when the hematocrit falls below 15% [24].

The fact that cerebral no-reflow probably has an inflammatory component makes it attractive to speculate that our observations may be attributed to the lesser inflammatory response associated with bloodless prime CPB. This notion is supported by the demonstration of improved cerebral no-reflow through the targeting of individual components of the inflammatory response. Leukocyte filtration [5], platelet activating factor antagonism [25], and steroid administration [26] all improve CBF after DHCA. Recently, the inhibition of platelet activation through glycoprotein IIb/IIIa antagonism has been shown to increase cerebral microvascular flow after DHCA, apparently through a reduction in platelet plugging [27]. We therefore suggest that the capability of the brain to exhibit a mild hyperemic response after DHCA is due to the reduced inflammatory load from avoiding allogeneic blood.

In non-CPB piglet studies of global cerebral ischemia, no preexisting inflammatory response is present, and a hyperemic response early in the reperfusion period is frequently seen [28]. This is then followed by a more sustained depression of cerebral blood flow (no-reflow) [29]. It may be that a similar phenomenon is occurring in this present model, but an extended survival period would be required to investigate this. Ischemia—either total or partial—is the common denominator in models exhibiting no-reflow. Although regional cerebral perfusion abnormalities occur during DHCLF, this is less consistently the case [10]. The variability in the CBF response seen in this study after DHCLF probably reflects this, and our choice to use a fixed low-flow rate that is independent of pressure.

This study supports previous reports from our laboratory suggesting that a bloodless prime is less inflammatory [11]. This difference is most pronounced when using DHCLF, probably due to the longer dynamic exposure to the extracorporeal circuit during continuous perfusion techniques; increased inflammation is a major expense associated with adopting continuous perfusion technique [30]. However, cerebral ischemia itself generates TNF{alpha}, and it is interesting that the group exposed to neither blood nor DHCA yielded the lowest levels of both systemic circulating TNF{alpha}, and intracerebral TNF{alpha} mRNA. It may be, therefore, that the inflammatory consequences of continuous perfusion techniques can be offset by the use of a bloodless prime whilst simultaneously avoiding periods of cerebral ischemia.

We have used TNF{alpha} as an experimental inflammatory marker because of its role as an apical cytokine capable of activating almost all arms of the downstream innate immune system. The importance of the inflammatory response—but TNF{alpha} in particular—in cerebral injury is now beginning to be recognized. In fact, TNF{alpha} (and interleukin-1ß) can itself initiate neuronal apoptosis in the absence of ischemia in neonatal models of perinatal brain injury [31]. In both global and regional stroke models, TNF{alpha} amplifies neuronal loss [32], and its antagonism is protective [33]. The demonstration here that deep hypothermic CPB using a bloodless prime leads to significantly less local production of TNF{alpha} in the brain is highly relevant.

There are two principal limitations of this study. First, we have only examined a brief window in the early post-CPB period. It would be extremely interesting to investigate a series of time-points in the postoperative period. Serial measurements were not possible in this study because of the progressive hemodilution that occurs with every data point. Longer survival would be difficult without postoperative blood administration, which would confuse the picture. Second, we have compared the use of fresh whole blood with an asanguinous prime. This does not address the role of packed red blood cells in exacerbating CPB-induced inflammation, and we can make no conclusions from this study to specifically avoid the use of leukocyte-depleted blood, the predominant form of red blood cells now in clinical practice.

This study, which represents our continued pursuit for more routine elimination of blood products in neonatal CPB, examined the cerebral recovery after deep hypothermic CPB using a bloodless prime. A hyperemic cerebrovascular response was observed after deep hypothermic circulatory arrest despite no overall change in cardiac output, and use of a bloodless prime was associated with significantly reduced cerebral production of TNF{alpha}.

Our continued pursuit of the study of circuit miniaturization has only been possible through the support of generous grants from the Medical Research Foundation of Oregon and the Children’s Heart Foundation, who have funded this and related preliminary work in our laboratory.


    Footnotes
 Top
 Abstract
 Introduction
 Material and Methods
 Results
 Comment
 Footnotes
 References
 
* Recipient of the 2005 Hawley H. Seiler Resident Award. Back


    References
 Top
 Abstract
 Introduction
 Material and Methods
 Results
 Comment
 Footnotes
 References
 

  1. von Segesser LK, Tozzi P, Mallbiabrrena I, Jegger D, Horisberger J, Corno A. Miniaturization in cardiopulmonary bypass Perfusion 2003;18:219-224.[Abstract/Free Full Text]
  2. Mou SS, Giroir BP, Molitor-Kirsch EA, et al. Fresh whole blood versus reconstituted blood for pump priming in heart surgery in infants N Engl J Med 2004;351:1635-1644.[Medline]
  3. Fransen E, Maessen J, Dentener M, Senden N, Buurman W. Impact of blood transfusions on inflammatory mediator release in patients undergoing cardiac surgery Chest 1999;116:1233-1239.[Medline]
  4. Molina JE, Einzig S, Mastri AR, et al. Brain damage in profound hypothermiaPerfusion versus circulatory arrest. J Thorac Cardiovasc Surg 1984;87:596-604.[Abstract]
  5. Langley SM, Chai PJ, Tsui SS, Jaggers JJ, Ungerleider RM. The effects of a leukocyte-depleting filter on cerebral and renal recovery after deep hypothermic circulatory arrest J Thorac Cardiovasc Surg 2000;119:1262-1269.[Abstract/Free Full Text]
  6. Rimpilainen J, Pokela M, Kiviluoma K, et al. Leukocyte filtration improves brain protection after a prolonged period of hypothermic circulatory arrest: a study in a chronic porcine model J Thorac Cardiovasc Surg 2000;120:1131-1141.[Abstract/Free Full Text]
  7. del Zoppo GJ, Schmid-Schonbein GW, Mori E, Copeland BR, Chang CM. Polymorphonuclear leukocytes occlude capillaries following middle cerebral artery occlusion and reperfusion in baboons Stroke 1991;22:1276-1283.[Abstract/Free Full Text]
  8. Hossmann KA. Reperfusion of the brain after global ischemia: hemodynamic disturbances Shock 1997;8:95-101discussion 2–3.[Medline]
  9. Myung RJ, Petko M, Judkins AR, et al. Regional low-flow perfusion improves neurologic outcome compared with deep hypothermic circulatory arrest in neonatal piglets J Thorac Cardiovasc Surg 2004;127:1051-1056discussion 6–7.[Abstract/Free Full Text]
  10. Mezrow CK, Sadeghi AM, Gandsas A, et al. Cerebral effects of low-flow cardiopulmonary bypass and hypothermic circulatory arrest Ann Thorac Surg 1994;57:532-539discussion 9.[Abstract/Free Full Text]
  11. Karamlou T, Schultz JM, Silliman C, et al. Using a miniaturized circuit and an asanguineous prime to reduce neutrophil-mediated organ dysfunction following infant cardiopulmonary bypass Ann Thorac Surg 2005;80:6-13discussion 13–4.[Abstract/Free Full Text]
  12. Van Oosterhout MF, Prinzen FW, Sakurada S, Glenny RW, Hales JR. Fluorescent microspheres are superior to radioactive microspheres in chronic blood flow measurements Am J Physiol 1998;275:H110-H115.[Medline]
  13. Schjerven H, Tran TN, Brandtzaeg P, Johansen FE. De novo synthesized RelB mediates TNF-induced up-regulation of the human polymeric Ig receptor J Immunol 2004;173:1849-1857.[Abstract/Free Full Text]
  14. Hickey E, Karamlou T, You J, Ungerleider RM. Effects of circuit miniaturization in reducing inflammatory response to infant cardiopulmonary bypass by elimination of allogeneic blood products Ann Thorac Surg 2006;81:S2367-S2372.[Abstract/Free Full Text]
  15. Karamlou T, Hickey E, Silliman CC, Shen I, Ungerleider RM. Reducing risk in infant cardiopulmonary bypass: the use of a miniaturized circuit and a crystalloid prime improves cardiopulmonary function and increases cerebral blood flow Semin Thorac Cardiovasc Surg Pediatr Card Surg Annu 2005:3-11.
  16. Wiesenack C, Liebold A, Philipp A, et al. Four years’ experience with a miniaturized extracorporeal circulation system and its influence on clinical outcome Artif Organs 2004;28:1082-1088.[Medline]
  17. Lau CL, Posther KE, Stephenson GR, et al. Mini-circuit cardiopulmonary bypass with vacuum assisted venous drainage: feasibility of an asanguineous prime in the neonate Perfusion 1999;14:389-396.[Abstract/Free Full Text]
  18. Darling E, Kaemmer D, Lawson S, et al. Experimental use of an ultra-low prime neonatal cardiopulmonary bypass circuit utilizing vacuum-assisted venous drainage J Extra Corpor Technol 1998;30:184-189.[Medline]
  19. Merkle F, Boettcher W, Schulz F, Koster A, Huebler M, Hetzer R. Perfusion technique for nonhaemic cardiopulmonary bypass prime in neonates and infants under 6 kg body weight Perfusion 2004;19:229-237.[Abstract/Free Full Text]
  20. Fang WC, Helm RE, Krieger KH, et al. Impact of minimum hematocrit during cardiopulmonary bypass on mortality in patients undergoing coronary artery surgery Circulation 1997;96(9 Suppl):II-194-II-199.
  21. Groom RC. High or low hematocrits during cardiopulmonary bypass for patients undergoing coronary artery bypass graft surgery?An evidence-based approach to the question. Perfusion 2002;17:99-102.[Free Full Text]
  22. Langley SM, Chai PJ, Miller SE, et al. Intermittent perfusion protects the brain during deep hypothermic circulatory arrest Ann Thorac Surg 1999;68:4-12discussion 12–3.[Abstract/Free Full Text]
  23. Mezrow CK, Sadeghi AM, Gandsas A, et al. Cerebral blood flow and metabolism in hypothermic circulatory arrest Ann Thorac Surg 1992;54:609-615discussion 15–6.[Abstract/Free Full Text]
  24. Sakamoto T, Nollert GD, Zurakowski D, et al. Hemodilution elevates cerebral blood flow and oxygen metabolism during cardiopulmonary bypass in piglets Ann Thorac Surg 2004;77:1656-1663discussion 63.[Abstract/Free Full Text]
  25. Langley SM, Chai PJ, Jaggers JJ, Ungerleider RM. Platelet-activating factor receptor antagonism improves cerebral recovery after circulatory arrest Ann Thorac Surg 1999;68:1578-1584discussion 85.[Abstract/Free Full Text]
  26. Langley SM, Chai PJ, Jaggers JJ, Ungerleider RM. Preoperative high dose methylprednisolone attenuates the cerebral response to deep hypothermic circulatory arrest Eur J Cardiothorac Surg 2000;17:279-286.[Abstract/Free Full Text]
  27. Mime LB, Arnhold S, Fischer JH, et al. Pharmacologic cerebral capillary blood flow improvement after deep hypothermic circulatory arrest: an intravital fluorescence microscopy study in pigs J Thorac Cardiovasc Surg 2005;130:670-676.[Abstract/Free Full Text]
  28. Greenberg RS, Helfaer MA, Kirsch JR, Traystman RJ. Effect of nitric oxide synthase inhibition on postischemic cerebral hyperemia Am J Physiol 1995;269:H341-H347.[Medline]
  29. Ulatowski JA, Kirsch JR, Traystman RJ. Hypoxic reperfusion after ischemia in swine does not improve acute brain recovery Am J Physiol 1994;267:H1880-H1887.[Medline]
  30. Schultz JM, Karamlou T, Swanson J, Shen I, Ungerleider RM. Hypothermic low-flow cardiopulmonary bypass impairs pulmonary and right ventricular function more than circulatory arrest Ann Thorac Surg 2006;81:474-480discussion 80.[Abstract/Free Full Text]
  31. Hsu CY, Shaikh A, Yeh CH, Dugan LL, Lin TS, Xu J. Enhancement of apoptosis in cerebral endothelial cells by selected inflammatory signals Ann N Y Acad Sci 1997;823:148-153.[Medline]
  32. Silverstein FS, Barks JD, Hagan P, Liu XH, Ivacko J, Szaflarski J. Cytokines and perinatal brain injury Neurochem Int 1997;30:375-383.[Medline]
  33. Lavine SD, Hofman FM, Zlokovic BV. Circulating antibody against tumor necrosis factor-alpha protects rat brain from reperfusion injury J Cereb Blood Flow Metab 1998;18:52-58.[Medline]



This article has been cited by other articles:


Home page
Asian Cardiovasc. Thorac. Ann.Home page
Y. Durandy
Warm Pediatric Cardiac Surgery: European Experience
Asian Cardiovasc Thorac Ann, August 1, 2010; 18(4): 386 - 395.
[Abstract] [Full Text] [PDF]


Home page
PerfusionHome page
H. D. Golab, J. J. Takkenberg, and A. J. Bogers
Specific requirements for bloodless cardiopulmonary bypass in neonates and infants; a review
Perfusion, July 1, 2010; 25(4): 237 - 243.
[Abstract] [PDF]


Home page
Ann. Thorac. Surg.Home page
R. Eggum, T. Ueland, T. E. Mollnes, V. Videm, P. Aukrust, A. E. Fiane, and H. L. Lindberg
Effect of Perfusion Temperature on the Inflammatory Response During Pediatric Cardiac Surgery
Ann. Thorac. Surg., February 1, 2008; 85(2): 611 - 617.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Personal Folders
Right arrow Download to citation manager
Right arrow Author home page(s):
Edward Hickey
Xiaomang You
Ross Ungerleider
Right arrow Permission Requests
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hickey, E.
Right arrow Articles by Ungerleider, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hickey, E.
Right arrow Articles by Ungerleider, R.
Related Collections
Right arrow Cerebral protection
Right arrow Extracorporeal circulation


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ANN THORAC SURG ASIAN CARDIOVASC THORAC ANN EUR J CARDIOTHORAC SURG
J THORAC CARDIOVASC SURG ICVTS ALL CTSNet JOURNALS