Ann Thorac Surg 2003;76:105-111
© 2003 The Society of Thoracic Surgeons
Original article: cardiovascular
Ischemic preconditioning is not cardioprotective in senescent human myocardium
Babett Bartling, PhDa,
Ivar Friedrich, MDa,
Rolf-E. Silber, MDa,
Andreas Simm, PhDa*
a Cardiothoracic Surgery, Martin Luther University Halle-Wittenberg, Halle/Saale, Germany
Accepted for publication January 18, 2003.
* Address reprint requests to Dr Simm, Klinik fuer Herz- und Thoraxchirurgie, Martin-Luther-Universitaet Halle-Wittenberg, Ernst-Grube-Str 40, D-06120 Halle, Saale, Germany.
e-mail: andreas.simm{at}medizin.uni-halle.de
 |
Abstract
|
|---|
BACKGROUND: Cellular and functional changes secondary to aging could impair myocardial tolerance to ischemia and affect the hearts response to ischemic preconditioning.
METHODS: We investigated the impact of cardiac aging on preconditioning in right atrial trabeculae of adult patients (
55 years) and senescent patients (
70 years) with coronary artery disease. Specimens were subjected to 30 minutes of simulated ischemia (hypoxic substrate-free superfusion) with and without 5 minutes of ischemic pretreatment. Postischemic contractile recovery was measured and expressed as percentage of base line force values.
RESULTS: During the reoxygenation period, trabeculae of adult patients but not those of senescent patients improved after ischemic preconditioning. After 40 minutes of reoxygenation, preconditioned adult trabeculae developed 57% ± 5% of their preischemic force (nonpreconditioned control 44% ± 5%, p < 0.01), senescent trabeculae recovered to 44% ± 4% (control 45% ± 3%). Especially myocardium from adult patients with Canadian Cardiovascular Society (CCS) stage III angina pectoris treated with ACE inhibitors recovered well (70% ± 7%; control 50% ± 8%, p < 0.01), contrasting with trabeculae from patients with CCS stage II angina (44% ± 5%; control 40% ± 10%). Ischemia-inducible Hsp70 (human heat shock protein) was additionally measured after reoxygenation. Total Hsp70 mRNA was elevated in preconditioned myocardium along with its contractile recovery (r = 0.33, p = 0.07). Because the control transcription, analyzing 18S rRNA and ß-actin, was reduced by ischemia but recovered in preconditioned trabeculae, relative Hsp70 mRNA was not altered.
CONCLUSIONS: Our data indicate that ischemic preconditioning has no beneficial effect on the postischemic functional recovery of senescent human myocardium.
 |
Introduction
|
|---|
The elderly with coronary artery disease represent an increasingly important and challenging patient population. Compared with younger patients this group experiences impaired recovery of myocardial function after cardiac surgery and after other cardiac interventions [1, 2], an observation that is undoubtedly attributable to age-related structural and functional changes. Such changes may also explain why acute myocardial infarction has a poor prognosis and high mortality among the elderly [3]. The increased sensitivity of the aging myocardium to ischemia [4] could also be a central risk factor in patients who are to undergo coronary artery bypass grafting.
Pretreating myocardium with brief intervals of ischemia and reperfusion diminishes cardiac damage induced by prolonged ischemia, leading to less myocyte necrosis and better functional recovery [5, 6]. This important phenomenon is called ischemic preconditioning and can be observed in different species. Clinically, ischemic preconditioning might play a role in successive exercise-induced ischemia (warm-up phenomenon) [7] and in mediating the protective effect of preinfarction angina pectoris [8]. In patients undergoing open heart procedures additional protection against ischemia-reperfusion injury can be induced by prior aortic cross clamping [9].
Abete and coworkers [10] showed in rats however that the effect of ischemic preconditioning is reduced in senescent myocardium. Retrospective analyses of human data also suggest a limited cardioprotective effect of preconditioning in the elderly [11, 12]. Detailed experimental evidence is lacking however, and no data are published on the potential therapeutic impact. Therefore we subjected isolated human myocardium from adult and senescent patients with coronary artery disease to ischemic pretreatment and subsequent simulated ischemia in a superfusion in vitro model. Because cardiac ischemia induces several compensatory cardioprotective responses such as strong upregulation of inducible isoforms of heat shock proteins [13], we also measured mRNA levels of Hsp70, the most abundant human heat shock protein.
 |
Material and methods
|
|---|
Experimental procedure
Right atrial trabeculae obtained from adult patients (aged 37 to 55 years) and senescent patients (aged 70 to 82 years) undergoing coronary bypass surgery were used in this study. All patients suffered from coronary artery disease (CAD) with angina pectoris but without atrioventricular valve defects. Exclusion criteria were right atrial pressures more than 12 mm Hg, atrial arrhythmias, and diabetes mellitus. Detailed patient characteristics are summarized in Table 1.
The study was approved by the local ethics committee (2001). Experiments were performed in accordance with the slightly modified protocol described by the Yellon group [6]. Immediately after removal atrial myocardium was kept in Tyrodes solution that was oxygenated with 95% O2/5% CO2 to yield a pH of 7.5. Fresh Tyrodes solution was prepared on a daily basis. It contained 5 mmol/L D-glucose, 1.8 mmol/L CaCl2, 120 mmol/L NaCl, 5.4 mmol/L KCl, 1.05 mmol/L MgCl2, 22.6 mmol/L NaHCO3, 0.42 mmol/L Na2HPO4, 0.05 mmol/L Na2EDTA, and 0.28 mmol/L ascorbic acid. Four trabeculae from each right atrial appendage were dissected and placed horizontally in an organ bath containing continuously oxygenated Tyrodes solution at 37°C. Once suspended, specimens were electrically stimulated at 1 Hz using platinum electrodes. A Modular Stimulator II (Hugo Sachs Elektronik, March-Hugstetten, Germany) produced a fixed pulse width of 1 ms and a mean pulse amplitude of 10 V (Table 2). Tensions were registered by a force transducer connected to a Servomed amplifier (Hellige, Freiburg, Germany). During the initial equilibration period of 60 minutes trabeculae were gradually stretched until the force of contraction was maximized. Thereafter, specimens were subjected to 30 minutes of experimental ischemia (hypoxic substrate-free Tyrodes solution) in combination with rapid pacing at 3 Hz, followed by 90 minutes of reoxygenation (normoxic solution exchanged every 20 minutes and finally after 30 minutes, stimulation at 1 Hz). To create ischemic conditions, Tyrodes solution was replaced by a glucose-free solution and the gas supply was switched to 95% N2/5% CO2; 7 mmol/L choline chloride was added to maintain constant osmolarity. Immediate desaturation to below 0.1% oxygen was verified with a Oxi 330i gas analyzer (WTW, Weilheim, Germany). In each experiment two trabeculae were ischemically preconditioned for 5 minutes followed by 10 minutes of reoxygenation, the most efficient preconditioning protocol for human atrial trabeculae [14]. The isometric force was recorded on paper and expressed in Nm (Servored 460; GMC Instruments, Nuernberg, Germany). Force of contraction was expressed as the percentage force of preischemic base line values. The exact base line functional characteristics of preconditioned and control trabeculae are listed in Table 2. Trabeculae of additional CAD patients (aged 55 to 70 years) that were superfused in the same time course but without ischemia served as nonischemic controls.
Rna preparation and reverse transcription polymerase chain reaction (rt-pcr)
For expression analyses trabeculae were immediately frozen in liquid nitrogen. Total RNA was extracted by the acid guanidinium thiocyanate-phenol-chloroform method and thereafter cleaned up with the RNeasy Mini Kit (Qiagen, Hilden, Germany). In a reverse transcription (RT) reaction, cDNA was synthesized from 200 ng of total RNA with 100 U Superscript II reverse transcriptase (Invitrogen, Groningen, Netherlands) at 42°C for 60 minutes. For polymerase chain reaction (PCR), primers for hsp70 (XM004188; sense 5'CCGAGAAGGAC GAGTTTGAG 3'; antisense 5'GGAAATGCAAAGTCTTGAAGC 3'), ß-actin (XM037235; sense 5'GAAGTGTGACGTGGACATCCG 3'; antisense 5'AGCATTT GCGGTGGACGAT), and 18S rRNA (M10098; sense 5'GTTGGTGGAGCGATTTGTCTG 3'; antisense 5'AGGGC AGGGACTTAATCAACGC 3') were chosen. A 1/10 cDNA reaction was used for PCR containing 1.5 mmol/L MgCl2, 5 pmol of each primer, 10 µmol/L of each dNTP, and 1 U rTaqDNA polymerase (Promega, Mannheim, Germany) in a final volume of 25 µL. Polymerase chain reaction amplification was performed after initial denaturation at 95°C for 2 minutes, 20 seconds at 94°C, 20 seconds at the primer-specific annealing temperature (60°C for 18S rRNA, ß-actin; 58°C for hsp70), and 30 seconds at 72°C. After gelelectrophoretic separation, intensity of PCR products was densitometrically evaluated (AIDA software; BioRad, Munich, Germany).
Data analysis
All data are means ± SEM. The number of patients in each evaluation group is given in Table 1. To compare preconditioned with control myocardium of the same patient, Students paired t test was used (SigmaStat software; Jandel, San Rafael, CA). For statistical evaluation of independent data, Students unpaired t test was applied. Single postischemic contractile force values always refer to 40 minutes of reoxygenation representing about half of the reoxygenation period. A p value of 0.05 or less was accepted as indicating a significant difference in mean values.
 |
Results
|
|---|
This study shows that the contractile force of isolated atrial myocardium from CAD patients recovers after ischemic preconditioning and simulated ischemia. Contractile force recovery was 50% ± 3.1% after 40 minutes (44% ± 2.7% in nonpreconditioned ischemic controls, p = 0.05) and 34% ± 2.9% after 90 minutes of reoxygenation (control 29% ± 2.7%, p = 0.05).
Effects of age and clinical variables
Age-dependent subgroup analysis revealed that preconditioning is primarily protective in adult CAD patients (55 years or younger). Atrial trabeculae from adults showed not only better base line contractility (Table 2) but also significantly better preservation of the postischemic function by preconditioning whereas preconditioning had no protective effect on trabeculae from patients older than 70 years (Fig 1).
As depicted in Figure 2 contractile recovery of adult myocardium depended strongly on the anginal stage Canadian Cardiovascular Society (CCS). In our adult population with CCS stage III angina, mean aortic pressures were higher
(91 ± 4 mm Hg compared with 77 ± 4 mm Hg in CCS II patients, p < 0.05), and left ventricular ejection fraction (LVEF) tended to be lowered (51% ± 5% versus 63% ± 3% in CCS II, p = 0.08) in this group that benefited most from preconditioning.

View larger version (19K):
[in this window]
[in a new window]
|
Fig 1. Ischemic preconditioning in isolated right atrial human myocardium from adult group (top) and senescent group (bottom) of coronary artery disease patients. Data are presented as mean ± SEM. *p less than 0.05, **p less than 0.01 versus individual control. Open boxes = ischemic control; solid boxes = 5-minute ischemic preconditioning.
|
|

View larger version (34K):
[in this window]
[in a new window]
|
Fig 2. Functional recovery of preconditioned atrial trabeculae of adult group (left) and senescent group (right) coronary artery disease patients after simulated ischemia versus patients Canadian Cardiovascular Society (CCS) stage angina pectoris and left ventricular ejection fraction (EF, 60% versus > 60%). Mean data ± SEM. **p 0.01 or less versus nonpreconditioned individual control; #p = 0.05 between control data. Open bars = ischemic control; hatched bars = 5-minute ischemic preconditioning force recovery after 40 minutes of reoxygenation.
|
|
Detailed analysis of the left ventricular function above and below the mean LVEF of 60%, which has been calculated from all CAD patients of the study, did not indicate a different preconditioning effect between patients with LVEF of 60% or less and those with LVEF more than 60%. Age-related evaluation of the ejection fraction revealed that especially low LVEF but adult CAD patients showed a significant preconditioning impact. Adults with such low ejection fractions (LVEF 48% ± 3%) are frequently characterized by CCS stage III angina (n = 5 of 9), whereas the adult high LVEF group (69% ± 3%) includes only 2 of 7 patients with CCS III. As shown in Figure 2 nonpreconditioned myocardium from adult patients with high LVEFs proved more resistant to ischemia than trabeculae from the group with low LVEFs but was not protected by ischemic pretreatment.
Effect of drug treatment
In a further subgroup analysis of all CAD patients we studied the impact of medical treatment with ß-blockers, angiotensin-converting enzyme (ACE) inhibitors, and nitrates (Table 1). In all CAD patients (63 ± 3 years) ß-blockers had a weak effect on the 40-minute postischemic recovery after preconditioning (52% ± 3.7% versus 45% ± 3.2% in ischemic controls, p < 0.05). CAD patients without ß-blockers therapy were not different in mean age (66 ± 4 years) or other clinical variables but their tissue was not protected by preconditioning (44% ± 5.6% postischemic force of contraction versus control 41% ± 5.2%). Breakdown by age revealed however no specific effect of ß-blockers on the preconditioned and nonpreconditioned myocardium in adult and senescent patients.
In addition to ß-blockers, ACE inhibitors influenced preconditioning as well. In preconditioned samples from all CAD patients (60 ± 3 years) who were under ACE inhibitor treatment, myocardial function at half of the reoxygenation period was found to be better (52% ± 3.8%; control 44% ± 3.7%, p < 0.05) than in patients without ACE inhibitors (67 ± 3 years). This protective impact of ACE inhibitor treatment was primarily seen in adult myocardium (Fig 3).
Both adult groups with and without ACE inhibitors had comparable LVEFs and CCS stages (ACE inhibitor posistive: LVEF 57% ± 3%, n = 6 of 13 CCS III; ACE inhibitor negative: LVEF 56% ± 8%, n = 3 of 8 CCS III), but only myocardium from ACE inhibitortreated patients responded to a significant degree to preconditioning. The best recovery was observed in adult patients with CCS stage III angina and ACE inhibitor treatment (70% ± 7% postischemic contractility versus control 50% ± 8%, p < 0.01) but also in adult myocardium from low LVEF patients (LVEF
60%, n
5; Fig 3).

View larger version (30K):
[in this window]
[in a new window]
|
Fig 3. Influence of angiotensin-converting enzyme inhibitor (ACE-I) therapy and left ventricular ejection fraction (EF, 60% versus > 60%) on postischemic contractile force of preconditioned atrial myocardium of adult group (top left) and senescent group (top right) coronary artery disease patients. Mean data ± SEM. **p 0.01 or less versus nonpreconditioned individual control; (#)p = 0.06 between control data. (Lower panel) ACE-I negative (neg.) (left) and ACE-I positive (pos.) (right). Open bars = ischemic control; hatched bars = 5-minute ischemic preconditioning force recovery after 40 minutes of reoxygenation.
|
|
When studying the influence of nitrates we did not find an impact on the ischemic preconditioning. Whereas adult CAD patients with nitrate therapy proved to have a higher contractile force of their preconditioned trabeculae during the reoxygenation (61% ± 6.8% versus control 50% ± 6.9%, p < 0.05), patients without nitrates recovered as well (54% ± 7.1% versus control 42% ± 6.2%, p < 0.05). In contrast to adults cardioprotection by preconditioning was not present in senescent myocardium with or without nitrate therapy (data not shown).
Mrna expression of inducible Hsp70
To analyze the molecular basis for our observations total RNA was extracted from atrial myocardium after the reoxygenation (n = 30) and quantitatively adjusted to the same amount. The mRNA expression of Hsp70 was determined in relation to ß-actin as control gene and to the quantity of ribosomal RNA. As indicated by 18S rRNA and ß-actin mRNA, myocardial transcription is reduced after ischemia and reoxygenation compared with nonischemic control samples (n = 7) but to a less extent in preconditioned myocardium (Fig 4).

View larger version (30K):
[in this window]
[in a new window]
|
Fig 4. (Top panel) Total postreoxygenation (reoxy.) level of 18S rRNA and ß-actin mRNA, adult and senescent groups, in preconditioned atrial myocardium and nonpreconditioned controls in comparison with superfused samples that were not subjected to ischemia (nonischemic controls, n = 7). Cross-hatched bars = nonischemic control; open bars = ischemic control; hatched bars = 5-minute ischemic preconditioning. (Middle panel) Graphics demonstrate the total and 18S rRNA-, ß-actin-normalized expression of Hsp70 mRNA in adult and senescent patients (n = 15 each group; left = total Hsp70 mRNA; right = relative Hsp70 mRNA). (Lower panel) Amount of Hsp70 mRNA in preconditioned myocardium relates to the improved contractile force after ischemic pretreatment ( = subtractive difference between data of preconditioned and nonpreconditioned samples). r and p are the results of a linear regression analysis (r = coefficient of correlation; p = statistical significance value.) All values are means ± SEM; *p less than 0.05, **p less than 0.01, and ***p less than 0.001 versus control. Solid circles = senescent group; open triangles = adult group. (RT-PCR = reverse transcription polymerase chain reaction.)
|
|
Age-related analysis revealed that the end-reoxygenation level of total Hsp70 mRNA is increased in preconditioned trabeculae of adults and less in senescent patients (n = 15 each group). Because the total level of 18S rRNA and ß-actin mRNA was changed as well, the relative expression of Hsp-70 mRNA was not altered in preconditioned samples (Fig 4). However increased level of total Hsp70 mRNA but not of 18S rRNA (r = 0.19) or ß-actin mRNA (r = 0.22) tends to correlate with the improved myocardial function by ischemic pretreatment (r = 0.33, p = 0.07).
 |
Comment
|
|---|
Reduction of infarct size, less jeopardized myocardial tissue, and better functional recovery are the hallmarks of ischemic preconditioning [5, 15]. These conclusions were drawn from animal models and cannot be directly transferred to humans because of differences between species and also for ethical reasons. There are some clinical reports however that preconditioning does occur in humans as well [7, 8, 16]. In vitro studies showed that preconditioning can protect isolated, isometrically contracting human atrial trabeculae from the adverse effects of simulated ischemia [6]. All published experimental data are derived from adult but not senescent myocardium, ignoring well-known ultrastructural and biochemical alterations that occur with age that might influence the hearts response to ischemic stress. Our study demonstrated that age is a main determinant for the severity of postischemic dysfunction and myocardial protection achieved with ischemic preconditioning. While preconditioning has positive effects on adult myocardium it fails to preserve the contractile function after simulated ischemia in myocardium from senescent patients with CAD. Although this study does not represent the influence of "natural" aging alone but in combination with CAD, these data support outcome from animal models demonstrating that aging hearts become more sensitive to ischemia despite ischemic pretreatment [10, 17]. Because such induction of tolerance to cardiac ischemia appears to play a role in both the warm-up phenomenon of CAD patients [7] and in angina pectoris [8] our results may shed some light on the loss of cardioprotection observed in the elderly under these clinical conditions [11, 18]. Furthermore, ischemic preconditioning by surgical interventions with subsequent preservation of the ventricular contractility was reduced in aged patients undergoing coronary artery bypass grafting, too [19].
The benefit of preconditioning was especially observed in adult CAD patients receiving ACE inhibitors. This finding corroborates experimental evidence suggesting the preservation of the preconditioning mechanism by concomitant blocking of the angiotensin pathway [20]. However, ACE inhibitor treatment failed to influence ischemic preconditioning in senescent myocardium. Further analyses revealed that antianginal therapy with ß-blockers can enhance the protective effect of myocardial preconditioning too but did not influence the ischemic tolerance in nonpreconditioned myocardium. These data contradict previous reports of Suematsu and colleagues [21] that ß-blockers improve the resistance against ischemia but eliminate the preconditioning effect. One possible reason might be that this study used nipradilol, a nitric oxidereleasing ß-adrenergic blocker. Exogenous nitric oxide has been shown to trigger preconditioning through formation of reactive nitrogen species while endogenous nitric oxide seems not to be involved [22]. Therefore nitrates might have an impact on our results because a patients myocardium would not respond to any additional stimulus. However CAD patients who received nitrates before cardiac surgery did not show an altered outcome of ischemic preconditioning in adult and senescent patients. In this regard one must also take into account that exogenous nitrate was most likely washed off during the equilibration period of all analyzed trabeculae.
Our study was performed with right atrial myocardium. Left ventricular hemodynamic indicators may indirectly influence preconditioning of atrial myocardium, as recently suggested by Ghosh and associates [23] who described a decline of atrial preconditioning in patients with poor cardiac function (LVEF < 30%). This contradicts results of a study by Tomai [24] who especially in patients with lower LVEF (<50%) demonstrated a protective effect of isoflurane, an anesthetic that mimics preconditioning. The findings by Ghosh and associatges [23] are also in contrast to our results because we observed a reduced ischemic tolerance of nonpreconditioned myocardium of low LVEF adults (LVEF 48% ± 3%, all
60%), but no loss of preconditioning. Nevertheless the LVEF-dependent data might be strongly influenced by different anginal stages. In this context we determined a beneficial effect of myocardial preconditioning in adults with severe angina pectoris (CCS stage III). These data are contrary to early experimental observations demonstrating that frequent ischemia results in an improved ischemic tolerance but also in the removal of the preconditioning mechanism [25], indicating that this myocardium is already protected by preceding ischemic episodes. However Figure 1 and other recent evidence suggest that the duration of protection is limited and repeated daily ischemic episodes can attenuate the severity of cardiac ischemia only (review [26]). This might be well possible in myocardial samples of our adult population with severe angina pectoris because we did not find an improved ischemic tolerance in nonpreconditioned myocardium but an easier inducible preconditioning mechanism.
Ischemia was shown to immediately induce Hsp70, and Hsp70 may thereby contribute to the physiologic recovery of ischemic hearts [27]. Based on this fact it has been postulated that Hsp70 and other heat stress proteins might be involved in ischemic preconditioning [28]. Therefore we analyzed the Hsp70 mRNA expression after reoxygenation in preconditioned and nonpreconditioned trabeculae. The most common approach to normalize gene expressions is the comparison with a constitutively expressed control gene like ß-actin. Because the steady-state levels of such control genes cannot always be assumed under hypoxic and other stress conditions [29] we also used the quantification of ribosomal RNA. As rRNA represents about 85% of the entire RNA, it is therefore an indicator of equal RNA loading. However even rRNA can be impaired as consequence of sublethal stress but recovered by Hsp70 overexpression [30]. This stress-altered gene transcription has also been shown in our study as indicated by 18S rRNA as well as ß-actin mRNA, which are clearly decreased in ischemic controls. However the amount of 18S rRNA and ß-actin mRNA was improved by preconditioning, demonstrating the cardioprotective effect in addition to the functional recovery. The Hsp70 mRNA was also increased in preconditioned myocardium of adults and less in senescent patients. Nevertheless the end-reoxygenation level of the relative Hsp70 mRNA (normalized per 18S rRNA, ß-actin mRNA) is not altered in senescent patients and in adults as well, who profited from the ischemic pretreatment. Although there is a tendency toward a direct correlation between increased total Hsp70 mRNA and recovered contractile force by preconditioning, unchanged relative Hsp70 mRNA levels do not indicate an active up-regulation in preconditioned myocardium. Therefore total Hsp70 values can also result from a secondary process and do not shed any light on the controversy about the precise role of stress proteins in the outcome of ischemic preconditioning [27, 28]. Recently it has been shown that ischemic tolerance induced by the warm-up phenomenon occurs without an elevation in heat shock proteins [31].
In summary in this in vitro study we demonstrated that in the elderly, ischemic preconditioning has no beneficial impact on postischemic contractile myocardial function. As ischemic insults are unavoidable when treating CAD by coronary angioplasty or coronary artery surgery further studies should focus on alternative strategies to protect the myocardium of elderly patients with CAD.
 |
Acknowledgments
|
|---|
The authors greatly appreciate the technical assistance of Thekla Wangemann and Anke Graul. Furthermore, we thank Fred H. Splittgerber, MD, for critically reading the manuscript. The work was partly done in the "Zentrum fuer angewandte medizinische Grundlagenforschung," ZAMED, Halle.
 |
References
|
|---|
- Reynen K., Bachmann K. Coronary arteriography in elderly patients: risk, therapeutic consequences and long-term follow-up. Coron Artery Dis 1997;8:657-666.[Medline]
- Hirose H., Amano A., Yoshida S., Takahashi A., Nagano N., Kohmoto T. Coronary artery bypass grafting in the elderly. Chest 2000;117:1262-1270.[Abstract/Free Full Text]
- Goldberg R.J., Gore J.M., Gurwitz J.H., et al. The impact of age on the incidence and prognosis of initial acute myocardial infarction: the Worcester Heart Attack Study. Am Heart J 1989;117:543-549.[Medline]
- Mariani J., Ou R., Bailey M., et al. Tolerance to ischemia and hypoxia is reduced in aged human myocardium. J Thorac Cardiovasc Surg 2000;120:660-667.[Abstract/Free Full Text]
- Cohen M.V., Liu G.S., Downey J.M. Preconditioning causes improved wall motion as well as smaller infarcts after transient coronary occlusion in rabbits. Circulation 1991;84:341-349.[Abstract/Free Full Text]
- Walker D.M., Walker J.M., Pugsley W.B., Pattison C.W., Yellon D.M. Preconditioning in isolated superfused human muscle. J Mol Cell Cardiol 1995;27:1349-1357.[Medline]
- Kelion A.D., Webb T.P., Gardner M.A., Ormerod O.J., Banning A.P. The warm-up effect protects against ischemic left ventricular dysfunction in patients with angina. J Am Coll Cardiol 2001;37:705-710.[Abstract/Free Full Text]
- Kloner R.A., Shook T., Przyklenk K., et al. Previous angina alters in-hospital outcome in TIMI 4. A clinical correlate to preconditioning?. Circulation 1995;91:37-45.[Abstract/Free Full Text]
- Lu E.X., Chen S.X., Yuan M.D., et al. Preconditioning improves myocardial preservation in patients undergoing open heart operations. Ann Thorac Surg 1997;64:1320-1324.[Abstract/Free Full Text]
- Abete P., Ferrara N., Cioppa A., et al. Preconditioning does not prevent postischemic dysfunction in aging heart. J Am Coll Cardiol 1996;27:1777-1786.[Abstract]
- Abete P., Ferrara N., Cacciatore F., et al. Angina-induced protection against myocardial infarction in adult and elderly patients: a loss of preconditioning mechanism in the aging heart?. J Am Coll Cardiol 1997;30:947-954.[Abstract]
- Napoli C., Liguori A., Cacciatore F., Rengo F., Ambrosio G., Abete P. "Warm-up" phenomenon detected by electrocardiographic ambulatory monitoring in adult and older patients. J Am Geriatr Soc 1999;47:1114-1117.[Medline]
- Knowlton A., Brecher P., Apstein C. Rapid expression of heat shock proteins in the rabbit after brief cardiac ischemia. J Clin Invest 1991;87:139-147.
- Ghosh S., Standen N.B., Galinanes M. Preconditioning the human myocardium by simulated ischemia: studies on the early and delayed protection. Cardiovasc Res 2000;45:339-350.[Abstract/Free Full Text]
- Przyklenk K., Bauer B., Ovize M., Kloner R.A., Whittaker P. Regional ischemic preconditioning protects remote virgin myocardium from subsequent sustained coronary occlusion. Circulation 1993;87:893-899.[Abstract/Free Full Text]
- Tomai F., Crea F., Chiariello L., Gioffre P.A. Ischemic preconditioning in humans: models, mediators, and clinical relevance. Circulation 1999;100:559-563.[Abstract/Free Full Text]
- Tani M., Suganuma Y., Hasegawa H., et al. Changes in ischemic tolerance and effects of ischemic preconditioning in middle-aged rat hearts. Circulation 1997;95:2559-2566.[Abstract/Free Full Text]
- Longobardi G., Abete P., Ferrara N., et al. "Warm-up" phenomenon in adult and elderly patients with coronary artery disease: further evidence of the loss of "ischemic preconditioning" in the aging heart. J Gerontol A Biol Sci Med Sci 2000;55:M124-129.
- Wu Z.K., Tarkka M.R., Pehkonen E., et al. Beneficial effects of ischemic preconditioning on right ventricular function after coronary artery bypass grafting. Ann Thorac Surg 2000;70:1551-1557.[Abstract/Free Full Text]
- Miki T., Miura T., Tsuchida A., et al. Cardioprotective mechanism of ischemic preconditioning is impaired by postinfarct ventricular remodeling through angiotensin II type 1 receptor activation. Circulation 2000;102:458-463.[Abstract/Free Full Text]
- Suematsu Y., Ohtsuka T., Horimoto H., et al. Long-term treatment with nipradilol, a nitric oxide-releasing beta-adrenergic blocker, enhances postischemic recovery and limits infarct size. Ann Thorac Surg 2002;73:173-179.[Abstract/Free Full Text]
- Nakano A., Liu G.S., Heusch G., Downey J.M., Cohen M.V. Exogenous nitric oxide can trigger a preconditioned state through a free radical mechanism, but endogenous nitric oxide is not a trigger of classical ischemic preconditioning. J Mol Cell Cardiol 2000;32:1159-1167.[Medline]
- Ghosh S., Standen N.B., Galinianes M. Failure to precondition pathological human myocardium. J Am Coll Cardiol 2001;37:711-718.[Abstract/Free Full Text]
- Tomai F., De Paulis R., Penta de Peppo A., et al. Beneficial impact of isoflurane during coronary bypass surgery on troponin I release. G Ital Cardiol 1999;29:1007-1014.[Medline]
- Cohen M.V., Yang X.M., Downey J.M. Conscious rabbits become tolerant to multiple episodes of ischemic preconditioning. Circ Res 1994;74:998-1004.[Abstract/Free Full Text]
- Yellon D.M., Dana A. The preconditioning phenomenon. Circ Res 2000;87:543-550.[Abstract/Free Full Text]
- Benjamin I.J., McMillan D.R. Stress (heat shock) proteins: molecular chaperones in cardiovascular biology and disease. Circ Res 1998;83:117-132.[Abstract/Free Full Text]
- Heads R., Latchman D., Yellon D.M. Differential stress protein expression during early ischemic preconditioning in the rabbit heart and its relationship to adenosine receptor function. J Mol Cell Cardiol 1995;27:2133-2148.[Medline]
- Zhong H., Simons J.W. Direct comparison of GAPDH, ß-actin, cyclophilin, and 28S rRNA as internal standards for quantifying RNA levels under hypoxia. Biochem Biophys Res Comm 1999;259:523-526.[Medline]
- Van Nieuwenhoven F.A., Martin X., Heijnen V.V.T., Conrnelussen R.N., Snoeckx L.H.E.H. HSP70-mediated acceleration of transcriptional recovery after stress is independent of ribosomal RNA synthesis. Eur J Cell Biol 2001;80:586-592.[Medline]
- Hamilton K.L., Powers S.K., Sugiura T., et al. Short-term exercise training can improve myocardial tolerance to I/R without elevation in heat shock proteins. Am J Physiol 2001;281:H1346-1352.
This article has been cited by other articles:

|
 |

|
 |
 
K. Boengler, R. Schulz, and G. Heusch
Loss of cardioprotection with ageing
Cardiovasc Res,
July 15, 2009;
83(2):
247 - 261.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. N. Peart and J. P. Headrick
Clinical cardioprotection and the value of conditioning responses
Am J Physiol Heart Circ Physiol,
June 1, 2009;
296(6):
H1705 - H1720.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D. O'Brien and S. E. Howlett
Simulated ischemia-induced preconditioning of isolated ventricular myocytes from young adult and aged Fischer-344 rat hearts
Am J Physiol Heart Circ Physiol,
August 1, 2008;
295(2):
H768 - H777.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Jahangir, S. Sagar, and A. Terzic
Aging and cardioprotection
J Appl Physiol,
December 1, 2007;
103(6):
2120 - 2128.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Liu, C. Long, B. Ji, H. Zhang, and F. Wen
Myocardial protective effects of nicorandil, an opener of potassium channels on senile rat heart
Perfusion,
May 1, 2006;
21(3):
179 - 183.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Di Lisa and P. Bernardi
Mitochondrial function and myocardial aging. A critical analysis of the role of permeability transition
Cardiovasc Res,
May 1, 2005;
66(2):
222 - 232.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Pasupathy and S. Homer-Vanniasinkam
Surgical Implications of Ischemic Preconditioning
Arch Surg,
April 1, 2005;
140(4):
405 - 409.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Liem, M. te Lintel Hekkert, O. C. Manintveld, F. Boomsma, P. D. Verdouw, and D. J. Duncker
Myocardium tolerant to an adenosine-dependent ischemic preconditioning stimulus can still be protected by stimuli that employ alternative signaling pathways
Am J Physiol Heart Circ Physiol,
March 1, 2005;
288(3):
H1165 - H1172.
[Abstract]
[Full Text]
[PDF]
|
 |
|