HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Add to Personal Folders Download to citation manager Permission Requests Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ryan, T. Articles by Smith, O. P. Search for Related Content PubMed PubMed Citation Articles by Ryan, T. Articles by Smith, O. P.

Ann Thorac Surg 2002;73:1905-1909
© 2002 The Society of Thoracic Surgeons

---

Original article: cardiovascular

Lactic acidosis after cardiac surgery is associated with polymorphisms in tumor necrosis factor and interleukin 10 genes

^a Departments of department of Anaesthesia, St James’s Hospital, Dublin, Ireland
^b Department of Hereditary Coagulation Disorders, St James’s Hospital, Dublin, Ireland
^c Department of Cardiothoracic Surgery, St. James’s Hospital, Dublin, Ireland

Accepted for publication February 17, 2002.

* Address reprint requests to Dr Ryan, Department of Anaesthesia, St. James’s Hospital, James St, Dublin 8, Ireland
e-mail: ryants{at}iol.ie

	Abstract

Top Abstract Introduction Patients and methods Results Comment Acknowledgments Appendix 1 Appendix 2 Appendix 3 References

 
Background. Lactic acidosis after cardiac surgery is a manifestation of excess cytokine production. Cytokine-related genetic polymorphisms account for variability in cytokine response and may predispose to the development of lactic acidosis after cardiac surgery.

Methods. Routine postoperative cardiac surgery patients were studied. Lactic acid levels were greater than 4 mmol/L in study patients and less than 4 mmol/L in controls. Polymerase chain reaction-based techniques were used to examine carriage of tumor necrosis factor ß (TNF-ß), TNF G-308A, and interleukin 10 (IL-10) G-1082A alleles.

Results. Demographic characteristics and details of surgery were similar for 30 control and 21 study patients. Lactic acid levels after intensive care admission changed over time and were related to both TNF-ß and IL-10 G-1082A polymorphisms. All 4 study patients homozygous for TNF-ß1 and carrying an IL-10–1082A allele developed lactic acidosis (p = 0.02). There was no relation between the rate of epinephrine infusion or duration of cardiopulmonary bypass and lactic acid levels.

Conclusions. Genetic factors have a role in the development of lactic acidosis after cardiac surgery.

	Introduction

Top Abstract Introduction Patients and methods Results Comment Acknowledgments Appendix 1 Appendix 2 Appendix 3 References

 
Lactic acidosis after cardiac surgery is an ominous event and is associated with excess mortality among patients in shock [1]. In pediatric cardiac surgery lactic acidosis is a powerful predictor of outcome with greater lactic acid levels associated with adverse outcome including excess mortality [2]. Lactic acidosis in cardiac surgical patients is a manifestation of systemic inflammation and excess proinflammatory cytokine production [3]. Systemic inflammation after cardiac surgery may also present as the "low systemic vascular resistance syndrome" with hypotension and high cardiac index and is always accompanied by lactic acidosis [3]. Lactic acid accumulation in shocked cardiac surgical patients is a net result of excess lactic acid production with unchanged utilization and is not related to altered carbohydrate metabolism [4]. This process may be a direct metabolic effect of tumor necrosis factor (TNF), as lactic acid production is increased by TNF-mediated inhibition of pyruvate dehydrogenase [5].

Interindividual variation in TNF production in patients with sepsis has been linked to polymorphisms in the TNF-ß gene [6]. Polymorphisms in the TNF- promoter gene are associated with excess mortality in septic shock [7]. Interleukin 10 (IL-10) is a potent antiinflammatory cytokine that inhibits TNF production. Polymorphisms in IL-10 promoter genes are associated with variation in IL-10 production [8]. It is plausible that these cytokine genomic polymorphisms modulate cytokine production and systemic inflammation in cardiac surgical patients and that the occurrence and severity of lactic acidosis in these patients is influenced by the presence of TNF and IL-10 genetic polymorphism. We conducted a study to test this hypothesis.

	Patients and methods

Top Abstract Introduction Patients and methods Results Comment Acknowledgments Appendix 1 Appendix 2 Appendix 3 References

 
Consenting patients scheduled for routine cardiac surgery with normal preoperative ventricular function and uneventful surgical procedures were recruited over a 6-month period. Patients with a history of hepatic disease were excluded. Patients were admitted to a dedicated cardiac surgical intensive care unit after surgery with care determined by the referring cardiac surgical service. Patient care was not modified for the purpose of the study. Cardiopulmonary bypass was performed using an open system primed with 1,500 mL of Hartmann’s solution with heparin-coated circuits and roller pumps. Suction systems were controlled.

Patient demographic characteristics and history of myocardial infarction, hypertension, congestive heart failure, vascular surgery, and diabetes were collected. The nature of the surgical procedure, duration of cardiopulmonary bypass and the minimum temperature on cardiopulmonary bypass (CPB), the first and last arterial blood gases on cardiopulmonary bypass, the blood flows and hemoglobin concentrations on cardiopulmonary bypass that corresponded with these blood gases, and the least blood flow on cardiopulmonary bypass were documented.

A case-control study was performed with study patients having arterial lactic acid level in excess of 4 mmol/L at any time in the first 24 hours after cardiac surgery and a control group with lactic acid level never greater than 4 mmol/L in the first 24 hours after surgery. Lactic acid levels, hemodynamics, inotropic requirement, arterial blood gases were recorded at the end of cardiopulmonary bypass, on arrival in the intensive care, and 6, 12, and 24 hours later. The duration of postoperative mechanical ventilation and the blood loss in the first 12 hours after surgery were recorded.

Genetic analysis was performed by a person who was unaware of group allocation and lactic acid levels. DNA was extracted from whole blood using overnight proteinase K (1 mg/mL) cell lysis at 37°C in the presence of 0.5% sodium dodecyl sulfate followed by extraction with phenol/chloroform and precipitation with ethanol. Polymerase chain reaction (PCR) amplification of all polymorphic sites was performed in a 50 µL total volume. The standard reaction mix consisted of Taq DNA Polymerase buffer with MgCl₂ (Promega; 50 mmol/L KCl, 10 mmol/L Tris-HCl [pH 9.0], 0.1% Triton X-100, and 1.5 mmol/L MgCl₂), 0.4 U of DNA Taq polymerase, 2 µL of genomic DNA, 4% dimethyl sulfoxide (DMSO), 30 µmol/L each of deoxyribonucleoside triphosphates, and 0.2 µmol/L each of sense primer and antisense primer (Appendix 1). The cycling variables for each assay are listed in Appendix 2, along with any changes to the standard PCR reaction mix. Restriction enzymes used for each assay are listed in Appendix 2. The IL-6, TNF-, IL-10–1082, and IL-10–592 PCR products were digested with the appropriate enzyme overnight at 37°C. The TNF-ß PCR product was digested for 3 hours at 37°C, and the IL-1ß PCR product was digested for 12 hours at 65°C. Restriction digest products were run in the appropriate percentage of agarose gel containing 1.6 µg/mL ethidium bromide.

Continuous variables were analyzed with Student’s t test and analysis of variance (ANOVA). The ² test and Fisher’s exact test were used to compare categorical variables. The relation between lactic acid levels and individual polymorphisms was analyzed at each time point using Student’s t test or ANOVA where appropriate. Where association between an individual polymorphism and lactic acid levels was detected on such a univariate test, then the interaction between polymorphism and change in lactic acid levels with time was analyzed by multivariate ANOVA (MANOVA) with repeated measures. The institutional ethics committee approved this study in March 1999.

	Results

Top Abstract Introduction Patients and methods Results Comment Acknowledgments Appendix 1 Appendix 2 Appendix 3 References

 
There were 30 control patients and 21 patients in the study group. Age, gender distribution, body surface area, preoperative chronic disease states, and the nature of surgical procedure were similar in both groups (Appendix 3). The minimum temperature on cardiopulmonary bypass was similar in study and control groups. Cardiopulmonary bypass time was longer in study patients; however, this difference did not reach statistical significance. Arterial partial pressure of carbon dioxide was greater in the study group at the end of cardiopulmonary bypass (4.74 ± 0.9 pKa versus 4.5 ± 0.7 pKa, p = 0.05). Otherwise arterial blood gases, hemoglobin, and circuit flow rates at the beginning and termination of cardiopulmonary bypass were similar in the two groups. Postoperative blood loss was similar in the two groups. The duration of mechanical ventilation was greater in the study group (Table 1).

There was no relation between blood pressure, central venous pressure, and genotype. There was no significant relation between genotype and postoperative blood loss. There was no association between lactic acid levels 6 hours after intensive care admission and infusion rate of epinephrine (lactic acid level mmol/L = 3.5 + 11.7 epinephrine g/kg per minute, p = 0.4).

	Comment

Top Abstract Introduction Patients and methods Results Comment Acknowledgments Appendix 1 Appendix 2 Appendix 3 References

 
In this study routine cardiac surgical patients displayed two distinct temporal patterns of lactic acidosis. The duration of cardiopulmonary bypass may have accounted for some of this difference yet the occurrence of postoperative lactic acidosis and the change in lactic acid levels over time was associated with the carriage of specific TNF and IL-10 alleles. A genotype was identified which was always associated with lactic acidosis, yet not all patients with lactic acidosis had this genotype.

Excess lactic acid accumulation after CPB has been attributed to splanchnic hypoperfusion with reperfusion in the initial hours following surgery and it is not inconceivable that visceral regional hypoperfusion might occur on a frequent basis during cardiopulmonary bypass. However, Haisjackl and colleagues [9] measuring splanchnic blood flow with indocyanine green and using gastric tonometry for mucosal pH measurement found no evidence of splanchnic hypoperfusion. Indeed post-CPB splanchnic perfusion and lactic acid levels were both increased compared with pre-CPB levels, suggesting that splanchnic lactic acid production after cardiac surgery is related to systemic inflammation. Cremer and associates [3] investigated the "low systemic vascular syndrome" after CPB and found that patients with low systemic vascular resistance had greatly increased levels of TNF and that this excess TNF was always associated with a concomitant lactic acidosis. Thus lactic acid production after CPB can be a manifestation of TNF-mediated systemic inflammation rather than hypoperfusion.

The association between inflammatory cytokines and excess lactic acid production is well recognized in sepsis related organ failure. In this setting excess production of lactic acid parallels excess inflammatory cytokine production in organs that are failing [10]. Vary and colleagues [5] in an animal model linked TNF with inhibition of pyruvate dehydrogenase and excess lactic acid production. Using a rat model of sepsis, they observed that anti-TNF antibody reversed both TNF-mediated pyruvate dehydrogenase inhibition and excess lactate production.

Epinephrine and other potent ß-adrenergic agonists may cause lactic acidosis [11]. The mechanism for this is unclear but a hypothesis suggests that coupling of membrane bound Na/K ATPases and anaerobic glycolytic enzymes may be responsible. Lactic acidosis has been reported with epinephrine administration after cardiopulmonary bypass [12]. Totaro and Raper [12] reported that 6 of 18 patients who received epinephrine after cardiopulmonary bypass developed lactic acidosis whereas none of 17 patients in a norepinephrine group had lactic acidosis. The study did not determine why only a third of patients developed acidosis in the epinephrine group. As this study did not include patients with lactic acidosis who did not require inotropic support, the occurrence of lactic acidosis in such patients was not investigated.

TNF- and TNF-ß are similar compounds and both are active at TNF receptors [13]. TNF- is primarily produced by activated monocytes and TNF-ß by activated lymphocytes. The B1 allele of the TNF-ß polymorphism was first associated with excess TNF-ß production by Messer and colleagues [14] and has been associated with greater severity of colitis by Koss and associategs [15]. Many polymorphisms in the TNF- promoter gene have been described and of these, the functional significance and disease association of the TNF-G–308A polymorphism is best documented. This TNF- polymorphism is associated with enhanced gene transcription [16], a 3.75-fold increase in mortality with septic shock [7], and a sevenfold excess mortality from cerebral malaria [17]. Thus TNF- and TNF-ß polymorphisms are functional and modulate inflammation. The TNF-B1 allele occurs with greater frequency than the TNF–308A allele and as a consequence it is easier to investigate in a small study such as this. The present study was too small to determine the effects of the TNF-G–308A polymorphism. IL-10 is a potent antiinflammatory cytokine that inhibits TNF production. The A allele of a polymorphism at position -1082 in the IL-10 gene promoter region is associated with lower IL-10 production [5]. In inflammatory bowel disease carriage of the IL-10–1082A allele is associated with greater severity of disease [15]. Thus a genotype associated with excess TNF-ß and a decrease in IL-10 could be characterized as proinflammatory. We observed that all patients with this genotype had excess lactic acid. If one considered an additional patient homozygous for TNF–308A and carrying the IL-10–1082A alleles in this proinflammatory genotype then the association would be more prominent.

This study demonstrated that a combination of cytokine genetic polymorphisms interact to promote lactic acidosis. It is possible that patients with this proinflammatory genotype may develop systemic inflammation and lactic acidosis after a lower threshold stimulus. However only 20% of patients in the study group had the identified genotype. Thus the proinflammatory genotype identified was sufficient but not necessary to initiate systemic inflammation. Further study is required to determine whether alternate genetic factors are associated with lactic acidosis in cardiac surgical patients. It is likely that the etiology underlying the generation of systemic inflammation after cardiopulmonary bypass is multifactorial. Surgical factors such as prolonged cardiopulmonary bypass and temperature reduction during cardiopulmonary bypass likely act as a trigger to precipitate systemic inflammation. We excluded patients with prolonged, complex, or eventful surgery and thus the effects of these factors were minimized. Further study is required to determine the relative importance of genetic and surgical factors in the occurrence of lactic acidosis after cardiac surgery.

The small size of this study and a focus on low-risk patients excluded any possibility of relating genotype and outcome measures. More extensive study for an association between genotype and outcome will follow this study. Having genetic information on a patient’s inflammatory response before surgery may have distinct benefits. Beside the basic science interest concerning the role and interaction of the inflammatory mediators, there could be very practical clinical benefits as those patients with genetic predisposition to high cytokine release may benefit from antiinflammatory mediator strategies.

	Acknowledgments

Top Abstract Introduction Patients and methods Results Comment Acknowledgments Appendix 1 Appendix 2 Appendix 3 References

 
This study was funded by a grant from the Royal City of Dublin Hospital Fund.

	Appendix 1

Top Abstract Introduction Patients and methods Results Comment Acknowledgments Appendix 1 Appendix 2 Appendix 3 References

 

Polymerase Chain Reaction Primer Sequences With Position of 5' Base, Restriction Enzymes, and Cut Sites Primer Sequence (5'-3') Position of 5' Base Restriction Enzyme Restriction Sites Variant Constant IL-6-174 sense ATGACTTCAGCTTTACTCTT -324 Hsp 92 II -174 -296 IL-6-174 antisense ATAAATCTTTGTTGGAGGGT -81 TNFB sense CCCTCCTGCACCTGCTGCCTGG +112 Hinf I +251 +196 TNFB antisense AGAGGGG TGGATGCTTGGGTTC +833 TNF-–308 sense GGAGGCAATAGGTTTTGAGGGCCAT -334 Nco I -313 -162 TNF-–308 antisense CTGTCTCGGT TTCTTCTCCATGGCG -140 IL-10–1082 sense TCTGAAGAAGTCCTGATGTC -1248 Mnl I -1085 -1196, -1191 IL-10–1082 antisense CTCTTACCTATCCCTACTTCC -1059 -1081 -1174 IL-10–592 sense GACTCCAGCCACAGAAGCTTA -967 Rsa I -594 -884, -842, -834 IL-10–592 antisense ATATCCTCAAAGTTCCCAAGC -531 IL-1ß +3953 sense GTGTTGTCATCAGACTTTGACCGTA +3816 Taq I +3952 +4052 IL-1ß +3953 antisense GAGAGCTTTCAGTTCATATCGACCA +4073

IL = interleukin; TNF = tumor necrosis factor.

	Appendix 2

Top Abstract Introduction Patients and methods Results Comment Acknowledgments Appendix 1 Appendix 2 Appendix 3 References

 

Polymerase Chain Reaction Cycling Parameters, Changes to Standard Reaction Mix, and Percentage Agarose Gel Used in Each Assay Polymorphism Cycles Denaturation Primer Annealing Elongation Changes to Standard Reaction Mix Agarose Gel IL-6–174 40 94°C, 1 min 58°C, 1 min 72°C, 90 sec 3% TNFB 37 95°C, 30 sec 68°C, 30 sec 74°C, 42 sec 1 µM of each primer 2% TNF-–308 40 94°C, 1 min 65°C, 1 min 72°C, 1 min 2% IL-10–1082 40 94°C, 1 min 58°C, 1 min 72°C, 1 min No DMSO 4% IL-10–592 40 94°C, 1 min 64°C, 1 min 72°C, 1 min 1 µM of each primer 3% IL-1ß +3953 40 94°C, 1 min 65°C, 1 min 72°C, 1 min 3%

IL = interleukin; TNF = tumor necrosis factor.

	Appendix 3

Top Abstract Introduction Patients and methods Results Comment Acknowledgments Appendix 1 Appendix 2 Appendix 3 References

 

Arterial Blood Gases and Blood Flow Rate on Cardiopulmonary Bypass Control Group Study Group p Value Initial   pH 7.38 ± 0.01 7.4 ± 0.01 NS   PCO2 (kPa) 4.95 ± 0.1 4.8 ± 0.1 NS   PO2 (kPa) 33.6 ± 1.9 36.6 ± 2.2 NS   Bicarbonate (mmol/L) 22 ± 0.2 22.1 ± 0.2 NS   Base excess -2.8 ± 0.3 -2.6 ±0.3 NS   Hemoglobin (g/dL) 9.8 ± 0.3 9.2 ± 0.3 NS   Flow L/m2 BSA 2.4 ± 0.03 2.4 ± 0.04 NS   Minimal flow L/m2 BSA 2.2 ± 0.05 2.1 ± 0.06 NS Final   pH 7.4 ± 0.01 7.39 ± 0.01 NS   PCO2 (kPa) 4.5 ± 0.07 4.7 ± 0.09 0.05   PO2 (kPa) 26.4 ± 1.2 25.9 ± 1.42 NS   Bicarbonate (mmol/L) 21.2 ± 0.2 21 ± 0.3 NS   Base excess -3.8±0.3 -4 ± 0.4 NS   Hemoglobin (g/dL) 9.4 ± 0.3 9.2 ± 0.3 NS   Flow L/m2 BSA 2.5 ± 0.02 2.5 ± 0.02 NS

BSA = Body surface area in square meters; NS = not significant.

	References

Top Abstract Introduction Patients and methods Results Comment Acknowledgments Appendix 1 Appendix 2 Appendix 3 References

 

1. Davies A.R., Bellomo R., Raman J.S., Gutteridge G.A., Buxton B.F. High lactate predicts failure of intra aortic balloon pumping after cardiac surgery. Ann Thorac Surg 2001;71:1415-1420.[Abstract/Free Full Text]
2. Duke T., Butt W., South M., Karl T. Early markers of adverse events in children after cardiac operations. J Thorac cardiovasc Surg 1997;114:1042-1052.[Abstract/Free Full Text]
3. Cremer J., Martin M., Redl H., et al. Systemic inflammatory response after cardiac operations. Ann Thorac Surg 1996;61:1714-1720.[Abstract/Free Full Text]
4. Chiolero R.L., Revelly J.P., Leverve X., et al. Effects of cardiogenic shock on lactate and glucose metabolism after heart surgery. Crit Care Med 2000;28:3784-3791.[Medline]
5. Vary T., Hazen S., Maish G., Cooney R. TNF binding protein prevents hyperlactaemia and inactivation of PDH complex in skeletal muscle during sepsis. J Surg Res 1998;80:44-51.[Medline]
6. Stuber F., Petersen M., Bokelmann F., Schade U. A genomic polymorphism within the tumor necrosis factor locus influences plasma tumor necrosis factor concentrations and outcome of patients with severe sepsis. Crit Care Med 1996;24:381-384.[Medline]
7. Mira J.P., Cariou A., Grall F., et al. Association of TNF2, aTNF-alpha promoter polymorphism, with septic shock susceptibility, and mortality: a multicenter study. JAMA 1999;282:579-581.[Free Full Text]
8. Turner D., Williams D., Sankaran D., Lazarus M., Sinnott P.J., Hutchinson I.V. An investigation of polymorphism in the interleukin-10 promoter gene. Eur J Immunogenet 1997;24:1-8.[Medline]
9. Haisjackl M., Birnbaum J., Redlin M., et al. Splanchnic oxygen transport and lactate metabolism during normothermic cardiopulmonary bypass in humans. Anaesth Anal 1998;86:22-27.[Abstract]
10. Douzinas E.E., Tsidemiadou P.D., Pitaridis M.T., et al. The regional production of cytokines and lactate in sepsis related multiple organ failure. Am J Resp Crit Care Med 1997;155:53-59.[Abstract]
11. James J.H., Luchette F.A., McCarter F.D., Fischer J.F. Lactate is an unreliable indicator of tissue hypoxia in injury or sepsis. Lancet 1999;354:505-508.[Medline]
12. Totaro R.J., Raper R.F. Epinephrine induced lactic acidosis following cardiopulmonary bypass. Crit Care Med 1997;25:1693-1699.[Medline]
13. Bazzoni F., Beutler B. The tumor necrosis factor ligand and receptor family. NEJM 1996;334:1717-1725.[Free Full Text]
14. Messer G., Spengler U., Jung M.C., et al. Polymorphic structure of the tumor necrosis factor (TNF) locus: an NcoI polymorphism in the first intron of the human TNF-ß gene correlates with a variant amino acid in position 26 and a reduced level of TNF-ß production. J Exp Med 1991;173:209-219.[Abstract/Free Full Text]
15. Koss K., Satsangi J., Fanning G.C., Welsh K.I., Jewell D.P. Cytokine (TNF alpha, LT alpha and IL-10) polymorphism in inflammatory bowel diseases and normal controls: differential effects on production and allele frequencies. Genes Immun 2000;1:185-190.[Medline]
16. Wilson A.G., Symons J.A., McDowell T.L., McDevitt H.O., Duff G.W. Effects of a polymorphism in the human tumor necrosis factor alpha promoter on transcriptional activation. Proc Natl Acad Sci 1997;94:3195-3199.[Abstract/Free Full Text]
17. McGuire W., Hill A.V., Allsopp C.E., Greenwood B.M., Kwiatkowski D. Variation in the TNF alpha promoter region associated with susceptibility to cerebral malaria. Nature 1994;371:508-510.[Medline]

This article has been cited by other articles:

				R. Alston, C Theodosiou, and K Sanger Changing the priming solution from Ringer's to Hartmann's solution is associated with less metabolic acidosis during cardiopulmonary bypass Perfusion, November 1, 2007; 22(6): 385 - 389. [Abstract] [PDF]

				R. Ryan, J. Thornton, E. Duggan, E. McGovern, M. J. O'Dwyer, A. W. Ryan, D. Kelleher, R. McManus, and T. Ryan Gene polymorphism and requirement for vasopressor infusion after cardiac surgery. Ann. Thorac. Surg., September 1, 2006; 82(3): 895 - 901. [Abstract] [Full Text] [PDF]

				H. Riha, J. A. Hubacek, R. Poledne, P. Kellovsky, A. Brezina, and J. Pirk IL-10 and TNF-beta gene polymorphisms have no major influence on lactate levels after cardiac surgery. Eur. J. Cardiothorac. Surg., July 1, 2006; 30(1): 54 - 58. [Abstract] [Full Text] [PDF]

				R P. Alston, L. Cormack, and C. Collinson Metabolic acidosis developing during cardiopulmonary bypass is related to a decrease in strong ion difference Perfusion, May 1, 2004; 19(3): 145 - 152. [Abstract] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Add to Personal Folders Download to citation manager Permission Requests Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ryan, T. Articles by Smith, O. P. Search for Related Content PubMed PubMed Citation Articles by Ryan, T. Articles by Smith, O. P.