ATS
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Personal Folders
Right arrow Download to citation manager
Right arrow Author home page(s):
Magdi H. Yacoub
Right arrow Permission Requests
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Borland, J. A.A.
Right arrow Articles by Yacoub, M. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Borland, J. A.A.
Right arrow Articles by Yacoub, M. H.

Ann Thorac Surg 2000;70:2054-2063
© 2000 The Society of Thoracic Surgeons

Original article: cardiovascular

Expression and function of angiotensin converting enzyme, chymase, and angiotensin II in the human radial artery and internal thoracic artery

Julie A.A. Borland, BSca, Adrian H. Chester, PhDa, Serena J. Rooker, PhDa, John Wharton, PhDb, Neil Davie, BScb, Mohamed Amrani, MD, PhDa, Magdi H. Yacoub, FRCSa

a Department of Cardiothoracic Surgery, National Heart and Lung Institute, Imperial College of Science, Technology and Medicine, Heart Science Centre, Harefield Hospital, Uxbridge, United Kingdom
b Department of Histochemistry, Imperial College School of Medicine, London, United Kingdom

Accepted for publication May 1, 2000.

Address reprint requests to Professor Yacoub, Department of Cardiothoracic Surgery, National Heart and Lung Institute, Imperial College of Science, Technology and Medicine, Heart Science Centre, Harefield Hospital, Hill End Road, Uxbridge, United Kingdom


   Abstract
Top
 Abstract
Introduction
 Material and methods
 Results
 Comment
 Acknowledgments
 References
 
Background. The potential role of the local renin-angiotensin system to differentially affect radial artery and internal thoracic artery graft performance has not been examined.

Methods. Contractile responses to angiotensin I and II in the radial artery and the internal thoracic artery were examined in vitro. The expression function, and localization of angiotensin receptors, angiotensin converting enzyme, and chymase were studied in radial artery and internal thoracic artery segments.

Results. Angiotensin I and II contractions were significantly greater (p < 0.05) in the radial artery compared to the internal thoracic artery. In both arteries, angiotensin II responses were mediated via the AT1 receptor. Messenger RNA transcripts for angiotensin-converting enzyme and chymase were detected in both arteries. Angiotensin-converting enzyme was localized to luminal and vaso vasorum endothelial cells and smooth muscle cells in both vessels, while chymase was colocalized with mast cells in adventitial and medial layers. An angiotensin converting enzyme or a chymase inhibitor singularly had no effect on angiotensin I contractions, however, when combined, a marked inhibition of the angiotensin I response was observed in both vessels.

Conclusions. Our results illustrate the complexities which exist within the local renin angiotensin system and suggest that clinical trials which may modulate the system are warranted.


   Introduction
Top
 Abstract
 Introduction
Material and methods
 Results
 Comment
 Acknowledgments
 References
 
The desire to achieve total arterial revascularization has led to a revival of the use of the radial artery (RA) as a coronary bypass conduit [1]. However, late graft patency and performance have not been fully assessed. Both early and late bypass graft function are dependent on the biological, physiological, and morphological properties of the vessel used, as well as the influence of endogenous and exogenous vasoactive agents. The radial artery being a very muscular artery, is prone to spasm and a number of contractile agents, including serotonin, norepinephrine, endothelin-1, and angiotensin II [2, 3] have demonstrated an enhanced reactivity in this vessel compared to the internal thoracic artery (ITA). Greater contractions to endothelin-1 and angiotensin II in the RA have been suggested to be the result of a higher receptor-mediated contractility in this artery [3].

Angiotensin II, a potent vasoconstrictor and smooth muscle cell mitogen, has been implicated in the development of arteriosclerosis [4] and may have the capacity to affect the performance of bypass conduits. Indeed an increase in the intensity of immunological staining for angiotensin converting enzyme (ACE) has been demonstrated in diseased coronary arteries when compared to normal vessels [5]. Previous studies in human saphenous vein and ITA measured a significantly greater local ACE activity and contractile response to angiotensin I and angiotensin II in the vein when compared to the artery [6], suggesting that the renin angiotensin system may potentially be involved in the development of the vascular changes associated with bypass graft failure.

The capacity of the RA to generate angiotensin II and the pathways involved in its formation, have not been investigated. Hence the aims of our study were to examine and compare the contractile effects of angiotensin I and angiotensin II, as well as the effects of inhibitors of angiotensin I conversion to angiotensin II on contractions to angiotensin I in the RA and the ITA.


   Material and methods
Top
 Abstract
 Introduction
 Material and methods
Results
 Comment
 Acknowledgments
 References
 
Tissue collection and storage
Short lengths of both distal RA (34 male patients, average age 57 years, and 3 female patients, average age 54 years) and ITA (45 male patients, average age 58 years, and 10 female patients, average age 65 years), were obtained from patients undergoing coronary artery bypass grafting. A no touch technique was used to harvest the RA graft to minimize both vessel wall damage and vasospasm development. Vessels were obtained prior to being exposed to vasodilator solutions. Following harvesting, both RA and ITA vessels were transported to the laboratory in sterile Hank’s balanced salt solution, pH 7.4, where loose connective tissue was removed. Vessel lengths were then either used in organ bath experiments, or snap frozen in liquid nitrogen (N2) for either gene expression studies, or immunohistochemical and autoradiographic studies. Preoperatively, patients were receiving a combination of medications, including, calcium antagonists, ß-blockers, potassium-channel blockers, nitrates, anticoagulants, analgesics, and antibiotics. No patient was prescribed angiotensin-receptor antagonists, while 23% of patients were receiving ACE inhibitors. None of the prescribed drugs either singly or when combined were observed to influence the experimental results.

Organ bath studies
Lengths of RA and ITA obtained were cut into 3 mm long segments, mounted on two metal hooks and lowered into a 5 ml organ bath chamber containing modified Krebs Henseleit solution, composition of (mmol/L), NaCl 136.9; NaHCO3 11.9; KCl 2.7; NaH2PO4 0.4; MgCl2 2.5; CaCl2 2.5; glucose 11.1, and disodium EDTA 0.04, which was heated to 37°C and gassed continuously with 5% CO2, 95% O2. After a 30 minute temperature equilibration period, an initial tension of 6 g was applied to RA segments and 4 g to ITA segments, after which a further 30 minute relaxation period was given. Smooth muscle cell contractility was measured by the addition of 90 mmol/L KCl to the bath. When a maximum contraction was reached, segments were washed with fresh Krebs. After a further 30 minute period of relaxation, an additional 1 g tension was given to each tissue individually and the response to 90 mmol/L KCl repeated. Independent vessel segment stretchings in 1 g steps were continued until for each vessel segment separately, two consecutive contractions to 90 mmol/L KCl were within 10% of each other.

The contractile effects of increasing concentrations of angiotensin I (10-10 to 10-6 mol/L) and angiotensin II (10-10 to 10-6 mol/L) were measured in the RA (angiotensin I, n = 20 and angiotensin II, n = 10) and compared with those responses observed in the ITA, (angiotensin I, n = 21 and angiotensin II, n = 18).

To characterize the angiotensin receptors responsible for contractions observed to both angiotensin I and angiotensin II in the RA and to angiotensin I in the ITA, vessels were incubated with either the AT1-receptor specific antagonist losartan (1 µmol/L) (RA, n = 8; ITA, n = 5) or the AT2-receptor specific antagonist PD123319 (1 µmol/L) (RA, n = 7; ITA, n = 5) for 30 minutes. After which time, in control and test segments, the responses to cumulative concentrations of either angiotensin I or angiotensin II (10-10 to 10-6 mol/L) were examined. The concentrations of receptor inhibitors used had previously been shown to significantly inhibit angiotensin II contractions in the IA and the saphenous vein [6].

In other segments of both RA and ITA, the role of ACE and the serine protease enzyme, chymase, in local conversion of angiotensin I to angiotensin II were examined. The RA (n = 5) and ITA (n = 5) segments were incubated with either the ACE inhibitor quinaprilat (1 µmol/L), or, the chymase inhibitor chymostatin (10 µmol/L) on their own or combined, for 40 minutes, or, the cathepsin G inhibitor, aprotinin (1 µmol/L) (RA, n = 5; ITA, n = 4) singularly for a similar period of incubation. After this time period the contractile response to angiotensin I (10-10 to 10-6 mol/L) was examined. In a similar series of experiments, in different segments of both RA (n = 9) and ITA (n = 7), vessels were incubated with either quinaprilat (1 µmol/L) or the broad spectrum serine protease inhibitor soya bean trypsin inhibitor (10 µmol/L), singularly, or combined for 40 minutes and again angiotensin I (10-10 to 10-6 mol/L) concentration response curves were carried out. The concentrations of angiotensin I converting enzyme inhibitors chosen had previously been shown to either significantly inhibit ACE and chymase activities and angiotensin I contractions [7–9] or, be of physiological concentrations [10].

Autoradiography studies
Angiotensin II binding sites were characterized and their locality within the wall of the RA examined using [125I]-(Sarcosine1-Isoleucine8) angiotensin II. Cryostat sections of RA, 10 µm thick, were cut, mounted onto Vectabonded (Vecta Labs, Peterborough, UK) coated microscope slides, and air dried. Sections were preincubated in 10 mmol/L sodium phosphate buffer (pH 7.4) containing 150 mmol/L NaCl, 10 mmol/L MgCl2, and 28 µmol/L bacitracin, for 10 minutes at room temperature, followed by incubation in fresh sodium phosphate buffer containing 0.25 nmol/L [125I]-(Sarcosine1-Isoleucine8) angiotensin II and 0.1% bovine serum albumin for 90 minutes at room temperature. Nonspecific [125I]-(Sarcosine1-Isoleucine8) angiotensin II binding was determined by co-incubation of adjacent sections with (1 µmol/L) unlabelled (Sarcosine1-Isoleucine8) angiotensin II. Angiotensin II binding sites were further characterized by inhibition studies, where consecutive sections were incubated with 0.25 nmol/L [125I]-(Sarcosine1-Isoleucine8) angiotensin II in the presence of either the AT1-selective antagonist losartan (1 µmol/L) or the AT2-selective antagonist PD123319 (1 µmol/L). After 90 minutes, sections were washed twice in ice cold phosphate buffer for 5 minutes, rinsed quickly in ice cold distilled water and dried under a stream of hot air. Macroautoradiographic images were obtained by exposing labelled sections to Hyperfilm3H (Amersham Pharmacin, Amersham, Buckinghamshire, UK), together with radiolabelled standard, for 14 days.

RNA extraction and cDNA synthesis
Frozen RA (n = 7) and ITA (n = 10) lengths of tissue weighing approximately 100 mg were ground in liquid nitrogen and total RNA extracted following the RNAzol B protocol (AMS Biotechnology, Witney, UK). One microgram of total RNA from each patient sample was reverse transcribed into first strand cDNA using an oligo dT primer and Superscript II reverse transcriptase (Life Technologies Inc, Paisley, UK).

Polymerase chain reaction amplification
Oligonucleotide primers were designed (primer 3 computer program), in accordance with the nucleotide sequences encoding human endothelial ACE [11], human heart chymase [12] and human ß-actin [13]. Primer sequences for ACE 5' CACCAATGACACGGAAAGTG 3' (sense), and 5' CAGCCTCATCAGTCACCAG 3' (antisense), and chymase, 5' CCTACATGGCCTACCTGGAA 3' (sense), and 5' CCTAGGATTAATTTGCCTGC 3' (antisense) were synthesized by Pharmacia Biotech, Hertfordshire, UK. The expected product sizes were 615 and 651 base pairs for ACE and chymase, respectively. Polymerase chain reaction (PCR) was performed using 100 ng cDNA for 35 cycles (30 seconds denaturing at 94°C; 30 seconds annealing at, 56°C for ACE and 60°C for chymase, and 30 seconds extension at 72°C), followed by a 10 minute extension step at 72°C in PCR buffer containing 10 mmol/L each dNTP, 0.1 mol/L dithiothreitol, 1.5 mmol/L MgCl2, 10 pmol/L each gene specific primer, and 2.5 units of Platinum Taq DNA polymerase (Life Technologies Inc, Paisley UK). Reference samples included human tricuspid valve endothelial cells for ACE and human left ventricle tissue for chymase. Negative controls for each tissue sample comprised of a cDNA reaction mixture minus reverse transcriptase enzyme. To assess the cDNA quantity used as a template, ß-actin cDNA [13] was amplified in a separate PCR reaction using primers with an annealing temperature of 60°C, 5' CCTCGCCTTTGCCGATCC 3' (sense) and 5' AAGCTGTAGCCGCGCTCG 3' (antisense), with an expected product size of 647 base pairs. The PCR products were visualized following polyacrylamide-gel electrophoresis (6%) and silver staining.

Sequence analysis
The nucleotide sequence of each PCR product was determined by cycle sequencing of both the sense and antisense DNA strands with radiolabelled (33PdATP) PCR primer following the manufacturer’s protocol (GibcoBRL, Paisley, UK).

Angiotensin-converting enzyme and chymase localization
Frozen sections of both RA and ITA (6 µm) were cut using a cryostat and mounted on polylysine coated slides, air dried and fixed in acetone. Sections were incubated for 30 minutes in either mouse antibodies to ACE (1.3 µg/ml) or chymase (1.6 µg/ml), or rabbit antibody to angiotensin II (1:300 dilution). Negative controls included incubation of separate sections with an irrelevant mouse antibody to the same immunoglobulin G subclass (IGg) as the monoclonal antibodies, or G fraction of serum from healthy nonimmunized rabbits. Subsequently, either biotinylated rabbit antimouse F(ab’2) (2.6 mg/ml) or biotinylated swine anti-rabbit F(ab’2) (1.1 µg/ml), both containing 1% human AB serum were applied to the appropriate sections for 30 minutes, followed by incubation in streptavidin biotin-peroxidase complexes for a further 30 minutes. Diaminobenzidine tetrahydrochloride (DAB), used for the detection of peroxidase activity, was applied to the sections for 5 minutes. Sections were then counterstained with Mayer’s hematoxylin, washed in tap water, dehydrated in a series of alcohols, cleared in xylene and mounted in DPX. All antibodies were diluted in 0.005 mol/L tris buffered saline, pH 7.6, and all incubations were followed by washes. The identity of mast cells in RA and ITA tissue sections was confirmed by incubating them for 30 minutes in 0.5% toluidine blue solution diluted in isopropanol. Sections were then blotted, rinsed in isopropanol, then xylene and mounted in DPX.

Statistical analysis
In organ bath experiments, contractile responses are expressed as either the mean of the absolute mN value ± the standard error of the mean (S.E.M.), or, as the mean response expressed as a percentage of the 90 mmol/L KCl contraction ± S.E.M. Statistical analysis was carried out by means of one way analysis of variance (ANOVA) followed by a Bonferroni t-test. Significance was taken as p value less than 0.05.

Materials
All salts required for the modified Krebs solution were purchased from BDH (Poole, UK). Angiotensin I and II were purchased from Sigma (Poole, UK). Losartan was a gift from Merck (Rahway, NJ), while PD123319 and quinaprilat were gifts from Parke-Davis (Ann Arbor, MI). Captopril, soya bean trypsin inhibitor, chymostatin, aprotinin, acetylcholine and norepinephrine, were purchased from Sigma, (Poole, UK). All drugs except quinaprilat were initially dissolved in distilled water, with further dilutions being made in Krebs Henseleit solution. [125I]-(Sarcosine1-Isoleucine8) angiotensin II and unlabelled (Sarcosine1-Isoleucine8) angiotensin II were obtained from Amersham Life Sciences, (Buckinghamshire, UK). Oligo dt (12–18) primers, superscript II reverse transcriptase, RNA guard and Platinum Taq DNA polymerase were all purchased from GibcoBRL (Paisley, UK). The enhanced 100 base pair ladder, gel loading dye and chloroform, were obtained from Sigma (Poole, UK). RNAzol B, was purchased from Tel-Test Inc (Friendswood, TX). Ethanol, acetic acid, formaldehyde, silver nitrate, ammonium persulphate, sodium borohydride and NNN’N’-Tetramethylethylene-diamine (TEMED) were bought from BDH, (Poole, UK). Both Tris Borate Na2 EDTA (TBE) and acrylamide were purchased from National Diagnostics (Hull, UK). Biotinylated antibodies and angiotensin II antibody were purchased from Peninsula Labs (St. Helens, UK), and ACE and chymase antibodies were purchased from Chemicon International Inc (Temecula, CA). Streptavidin biotin peroxidase was purchased from Dako (High Wycombe, UK) and DAB from Sigma (Poole, UK).


   Results
Top
 Abstract
 Introduction
 Material and methods
 Results
Comment
 Acknowledgments
 References
 
Organ bath studies
Segments of both RA and ITA, produced significant contractions to 90 mmol/L KCl. These contractions were significantly greater (p < 0.05, data not shown) in the RA (n = 20) when compared to the ITA (n = 21).

In the RA and ITA, increasing concentrations of both angiotensin I (RA, n = 20; ITA, n = 21) (Fig 1A) and angiotensin II (RA, n = 10; ITA, n = 18) (Fig 1B), produced concentration dependent contractions, with similar curve profiles. However, the RA produced significantly greater (p < 0.05) maximum contractions in response to both peptides when compared to the ITA. This difference persisted even when the responses to angiotensin I and II were normalized to the potential contractility of the vessel wall, as judged by the response to 90 mmol/L KCl. A significant (p < 0.05) rightward shift of angiotensin I curves compared to angiotensin II curves was evident in both the RA (EC50 = 0.22 ± 0.047 µmol/L, versus 6.9 ± 2.1 nmol/L) and the ITA (EC50 = 0.24 ± 0.052 µmol/L versus 49 ± 3.3 nmol/L), respectively. The rightward displacement in the angiotensin I curve observed corresponded to an approximate 30 and a 5 fold shift in the RA and the ITA, respectively. Patients receiving ACE inhibitors preoperatively demonstrated no significant differences in maximum contractions or in potency to angiotensin I in vessel segments of RA (n = 3 patients) (maximum effect, 56.6 ± 4.70 mN; EC50 = 0.12 ± 0.06 µmol/L) when compared to patients net receiving ACE inhibitors (n = 17 patients) (maximum effect, 64.07 ± 5.81 mN; EC50 = 0.24 ± 0.05 µmol/L). Differences in angiotensin I responses in the ITA were not examined as no patient was receiving ACE inhibitors. In RA vessel segments (n = 8 patients) incubated with the AT1-receptor antagonist losartan (1 µmol/L), angiotensin II (10-10 to 10-6 mol/L) contractions were significantly inhibited (p < 0.05) (Fig 2). In contrast, the AT2-receptor antagonist PD123319 demonstrated no inhibitory effect at all concentrations of the octapeptide (n = 7 patients) (Fig 2). Similar AT1-receptor dependent inhibition of angiotensin I (10-10 to 10-6 mol/L) contractions were also observed in the RA (n = 8) and ITA (n = 5), with maximum contractions in RA control vessels being 70% ± 46.6% compared to 3.7% ± 0.5% in losartan treated segments (p < 0.05). In ITA vessels, angiotensin I contractions were completely inhibited in the presence of losartan (p < 0.05).



View larger version (12K):
[in this window]
[in a new window]
  		Fig 1. The contractile response of human radial artery (squares) and internal thoracic artery (circles) vessel segments to increasing concentrations of (A) angiotensin I (10-10 to 10-6 mol/L) and (B) angiotensin II (10-10 to 10-6 mol/L). Values are expressed as the mean of the absolute contractile response (mN) ± standard error of the mean. *p < 0.05 for radial artery compared to internal thoracic artery.

 


View larger version (18K):
[in this window]
[in a new window]
  		Fig 2. The contractile effect of angiotensin II (10-10 to 10-6 mol/L) in the radial artery, in the presence of either vehicle (squares), the AT1-receptor antagonist losartan (1 µmol/L) (circles), or the AT2-receptor antagonist PD123319 (1 µmol/L) (triangles). Contractions are expressed as the mean percentage of the response to 90 mmol/L potassium chloride ± standard error of the mean. *p < 0.05 for control versus losartan.

 
When examining the potential role of ACE and the converting enzyme chymase, in the angiotensin I responses observed in the RA (n = 5 patients) and the ITA (n = 5 patients), neither the ACE inhibitor quinaprilat (1 µmol/L), nor the chymase inhibitor chymostatin (10 µmol/L), on their own, produced a significant rightward shift of the angiotensin I contractile curve, or a reduction in maximum effect (p = NS) (Fig 3A and 3B). However when combined, a marked rightward shift in the angiotensin I curves and a reduction in maximum contraction were observed but these differences were not significantly different to control responses (p = NS) (Fig 3A and 3B). Similarly, in a separate series of experiments’ the ACE inhibitor captopril (1 µmol/L) also failed to inhibit the response to angiotensin I (RA, n = 6 patients; ITA, n = 6 patients, (p = NS), data not shown). This lack of effect of ACE inhibitors was not due to damage to the vascular endothelium, as concentration dependent relaxations to acetylcholine (10-9 to 10-4 mol/L) (n = 4) were observed in the RA, with a maximum effect of 91.8% ± 9.8%. No patient from whom RA and ITA vessels were obtained and used to study the effects of converting enzyme inhibition on angiotensin I contractions, were receiving ACE inhibitors.



View larger version (15K):
[in this window]
[in a new window]
  		Fig 3. The contractile response of angiotensin I (10-10 to 10-6 mol/L) in (A) the radial artery and (B) the internal thoracic artery, in the presence of either vehicle (squares), the ACE inhibitor quinaprilat (1 µmol/L) (circles), the chymase inhibitor chymostatin (10 µmol/L) (triangles), or both quinaprilat (1 µmol/L) and chymostatin (10 µmol/L) combined (diamonds). Contractions are expressed as the mean percentage of the response to 90 mmol/L potassium chloride ± standard error of the mean.

 
Similarly, in an analogous series of experiments, where chymostatin (10 µmol/L) was replaced with the broad spectrum serine protease inhibitor soya bean trypsin inhibitor (10 µmol/L) although there again appeared to be a notable rightward shift of the curve when both inhibitors were present at identical concentrations in both arteries, observations were not significantly different to those seen in control vessels (RA, n = 9 patients; ITA, n = 7 patients, each group, p = NS, data not shown). Incubation of both arteries with the cathepsin G inhibitor, aprotinin (1 µmol/L) had no inhibitory effect on the angiotensin I response in either vessel (RA, n = 5 patients; ITA, n = 4 patients, each group, p = NS, data not shown). When quinaprilat (1 µmol/L) and aprotinin (10 µmol/L) were combined, no additional inhibition was observed to that previously seen when ACE and chymase inhibitors were combined, in both vessel types (RA, n = 5 patients; ITA, n = 5 patients, each group, p = NS, data not shown).

Autoradiography
Radial artery sections demonstrated specific [125I]-(Sarcosine1-Isoleucine8) angiotensin II binding (Fig 4A) that was completely inhibited in the presence of excess (1 µmol/L) unlabelled (Sarcosine1-Isoleucine8) angiotensin II (Fig 4B) and also by incubation with the AT1-selective antagonist losartan (1 µmol/L) (Fig 4C), but not by the AT2-selective inhibitor PD123319 (1 µmol/L) (Fig 4D). Nonspecific binding represented less than 5% of total binding.



View larger version (89K):
[in this window]
[in a new window]
  		Fig 4. A representative example of transverse sections of human radial artery illustrating [125I]-(Sarcosine1-Isoleucine8) angiotensin II (2.5 nmol/L) binding in (A) the absence (total) of unlabelled (Sarcosine1-Isoleucine8) angiotensin II and (B) the presence of unlabelled peptide (2.5 nmol/L) (nonspecific binding), as well as (C) in the presence of the AT1-selective competitor losartan (1 µmol/L), and (D) in the presence of the AT2-selective competitor PD123319 (1 µmol/L). Scale bar = 2 mm. Panel (E) is a cross section of the same radial artery stained with Mayer’s hematoxylin and eosin, scale bar = 0.4 mm. (L = the blood vessel lumen; M = medial layer.)

 
Angiotensin converting enzyme and chymase gene expression
Both ACE and chymase messenger RNA transcripts were amplified by reverse transcriptase-PCR, from cDNA preparations of all RA and ITA patient samples used. Amplified transcripts were of the expected size, which was 615 base pairs for ACE and 651 base pairs for chymase (Fig 5A and B, upper gels, respectively). Sequence analysis confirmed the identity of both ACE and chymase in both arteries. Amplification of the housekeeping gene ß-actin was detectable in all samples (Figs 5A and B, lower gels).



View larger version (76K):
[in this window]
[in a new window]
  		Fig 5. Reverse transcription–polymerase chain reaction amplification of angiotensin converting enzyme and chymase from cDNA prepared from a representative example of (A) radial artery and (B) internal thoracic artery. Lanes 1 and 2 show polymerase chain reaction negative controls for angiotensin converting enzyme and chymase, respectively. Lane 3 shows the amplification products for angiotensin converting enzyme with positive control cDNA prepared from human tricuspid valve endothelial cells. Lane 4 shows the amplification products for chymase with positive control cDNA prepared from human left ventricle. Lanes 5 and 6 are the amplified products for angiotensin converting enzyme 615 base pairs (bp) and chymase 651 bp, respectively (upper gels). All vessel segments amplified the housekeeping gene ß-actin (lower gels). Markers (M) were enhanced 100 bp DNA ladder.

 
Angiotensin converting enzyme and chymase localization
In cross sections of RA and ITA, strong positive staining for angiotensin II (shown in dark gray and black) (Fig 6A and B) was observed in the media of both vessel types. Angiotensin converting enzyme was localized to the endothelial cells lining the lumen of the vessel wall, as well as those in the vaso vasorum in the adventitia of both arteries (Figs 6C and D). Paler staining for ACE was also observed in the smooth muscle layer of both the RA and the ITA (Figs 6C and D). Strong positive staining for chymase was colocalized with mast cells and their released granules in both arteries (Figs 6E and F), which were mainly present in the adventitial layer and occasionally in the medial layer of the RA. Control sections appeared negative (Figs 6G and H).



View larger version (126K):
[in this window]
[in a new window]
  		Fig 6. Transverse sections of representative examples of human radial artery (panels A, C, E, and G) and internal thoracic artery (panels B, D, F, and H), stained with an immunohistochemical technique, showing positive staining (dark gray and black) (filled black arrows) for angiotensin II (ANG II) localized to the medial layer of the blood vessels (A and B), positive staining for angiotensin converting enzyme (ACE) localized to the luminal endothelial cells and those lining the vasa vasorum (C and D) (filled black arrows), as well as paler staining in the smooth muscle layer. Panels E and F demonstrate positive staining for chymase in the granules contained within the mast cells as well as those released into the adventitia (filled black arrows). No staining was observed in control sections (G and H). The scale bar = 0.2 mm. (L = lumen; M = medium; A = ventitia.)

 

   Comment
Top
 Abstract
 Introduction
 Material and methods
 Results
 Comment
Acknowledgments
 References
 
This study demonstrated the potent vasoconstrictor action of angiotensin I and angiotensin II in the RA, where contractions were significantly greater than those observed in the ITA. In both arteries angiotensin II was significantly more potent than angiotensin I. In the RA and the ITA, angiotensin I contractions were mediated via the AT1-receptor. Similarly, the AT1-receptor and not the AT2-receptor, was also responsible for contractions observed to angiotensin II in the RA, as previously demonstrated in the ITA [6]. Angiotensin I contractions in the RA were not able to be significantly inhibited by either of the ACE inhibitors, captopril or quinaprilat, or the chymase inhibitors, chymostatin or soya bean trypsin inhibitor, on their own. Similarly, when an ACE inhibitor was combined with a chymase inhibitor, although a notable rightward shift in the angiotensin I curve was observed in both vessel types, this shift was not significant compared to control responses. These results suggest that angiotensin II formation in both arteries is only partially and not totally, dependent on ACE and chymase but rather may involve yet another enzyme pathway which we have not characterized in this study. We have not addressed the potential nonspecific effects of quinaprilat and chymostatin combined on vascular smooth muscle contractions. However, we believe such effects are unlikely, considering previous studies which demonstrate that ACE inhibition does not affect receptor-mediated vasoconstriction or pressor effects due to membrane depolarization [14]. An assumption made in this study was that angiotensin I is inactive and requires conversion to the active peptide angiotensin II. However we have not quantified angiotensin II generation. This will require further studies.

In our experiments all RA segments used, demonstrated good endothelial function. An intact endothelium is known to counteract the proliferative properties of angiotensin II by releasing prostaglandins and endothelium derived relaxing factor [15]. The improved RA graft performance may be in part attributable to better preservation of the endothelium resulting from increased knowledge of its vasoprotective and biological capabilities. Such protection may be credited to improved surgical graft harvesting techniques, with decreased handling, implementation of passive dilation and bathing the free graft in a vasodilator solution [16].

The contribution of local vascular ACE in the generation of angiotensin II has been examined extensively. In the past decade much evidence has accumulated suggesting the involvement of not only ACE, but also of a serine protease enzyme, chymase, in the formation of angiotensin II. Indeed high levels of chymase activity have been measured in many human organs including the stomach, uterus, and colon, while more moderate and lower levels were detected in human cardiac ventricular tissues, coronary arteries and aorta [17]. Dual-enzyme pathways have previously been demonstrated in the saphenous vein [18], ITA [19], and gastroepiploic arteries [20] as well as in human coronary arteries [21], aorta [22] and the microvascular circulation [9]. Our findings although suggesting some involvement of both ACE and chymase enzymes in local angiotensin II formation, indicate the existence within the RA and the ITA of an angiotensin I converting enzyme pathway independent of those two enzymes. Chymostatin has a broad enzyme specificity and is able to inhibit not only chymase but also cathepsin G, hence by using aprotinin, which inhibits cathepsin G and not chymase, we were able to examine the contribution of this enzyme in the conversion of angiotensin I in both vessels.

The in vivo contribution of a non ACE, non-chymase converting enzyme in angiotensin II formation may be overestimated in vitro. Recently, it was demonstrated that in human heart tissues incubated in vitro with interstitial fluid isolated from the skin and containing naturally occurring protease inhibitors, chymase-mediated angiotensin II formation was almost totally suppressed [23]. Such protease inhibitors present in interstitial fluid in the human vasculature may result in ACE regulated production in vivo. The role of interstitial fluid proteases with regard to angiotensin II formation in the RA in vivo, should be investigated further.

The RA has been shown not only to have an increased contractility to norepinephrine and serotonin [2] when compared to the ITA but also to angiotensin II [3]. We also not only demonstrated contractions to angiotensin II in the RA of approximately 10 times that of the ITA but also a similar magnitude of difference in response to the decapeptide angiotensin I. It is suggested that such increased contractility to angiotensin II in the RA is a result of a higher receptor mediated contractility rather than a difference in their sensitivity to angiotensin II, or due to a difference in endothelial function [3]. We also observed there to be a predominance of AT1- over AT2-binding sites in the RA. Such findings, along with the observed lack of inhibition of angiotensin II formation in the presence of converting enzyme inhibitors may highlight the potential benefits of AT1-receptor antagonists for the prevention of RA graft spasm during graft preparation and postoperatively. Our findings are in agreement with the recent findings of Strawn and colleagues [24], who demonstrated that losartan significantly inhibited fatty streak formation in the aorta, coronary and carotid arteries in adult male cynomolgus monkeys [24]. Treatment with losartan also reduced low-density lipoprotein oxidation and suppressed circulating monocyte and adhesion molecule expression [24]. Similarly, in human resistance arteries removed from patients with mild hypertension, losartan was shown to correct the altered structure and endothelial function of these vessels [25]. The significance of the few AT2-binding sites detected in the RA has not been established.

In conclusion, we have defined the expression, locality, and function of components of the renin angiotensin system in the RA when compared to the ITA. We have demonstrated a greater contractile response to both angiotensin I and angiotensin II peptides in the RA this response being mediated via the AT1 receptor. The conversion of angiotensin I to angiotensin II was not totally dependent on ACE or chymase in either artery. The increased contractility observed in the RA may have important clinical implications particularly in the immediate postoperative period when maintaining graft patency and adequate blood flow to the myocardium are vital. Our results illustrate the complexities which exist within the local renin angiotensin system and suggest that clinical trials which may modulate this system are warranted.


   Acknowledgments
Top
 Abstract
 Introduction
 Material and methods
 Results
 Comment
 Acknowledgments
References
 
This study was carried out in the Department of Cardiothoracic Surgery at Harefield Hospital. We acknowledge Dr Karen A. Morrison for her advice with the immunohistochemistry, as well as Mrs Camilla A. Sproson and the theater staff at Harefield Hospital for their help with tissue collection.


   References
Top
 Abstract
 Introduction
 Material and methods
 Results
 Comment
 Acknowledgments
 References
 

  1. Buxton B.F., Fuller J.A., Tatoulis J. Evolution of complete arterial grafting for coronary artery disease. Texas Heart Inst J 1998;25:17-23.[Medline]
  2. Chardigny C., Jebara V.A., Acar C., et al. Vasoreactivity of the radial artery. Comparison with the internal mammary and gastroepiploic arteries with implications for coronary artery surgery. Circulation 1993;88:II115-II127.
  3. He G.W., Yang C.Q. Radial artery has higher receptor-mediated contractility but similar endothelial function compared with mammary artery. Ann Thorac Surg 1997;63:1346-1352.[Abstract/Free Full Text]
  4. Dzau V.J. Cell biology and genetics of angiotensin in cardiovascular disease. J Hypertens 1994;12(Suppl):S3-S10.
  5. Diet F., Pratt R.E., Berry G.J., Momose N., Gibbons G.H., Dzau V.J. Increased accumulation of tissue ACE in human atherosclerotic coronary artery disease. Circulation 1996;94:2756-2767.[Abstract/Free Full Text]
  6. Borland J.A., Chester A.H., Crabbe S., Parkerson J.B., Catravas J.D., Yacoub M.H. Differential action of angiotensin II and activity of angiotensin-converting enzyme in human bypass grafts. J Thorac Cardiovasc Surg 1998;116:206-212.[Abstract/Free Full Text]
  7. Crabbe S., Borland J.A., Catravas J.D., Chester A.H., Yacoub M.H. Activity of the renin angiotensin system in human bypass grafts. Circulation 1996;94(Suppl):I223.
  8. Urata H., Kinoshita A., Misono K.S., Bumpus F.M., Husain A. Identification of a highly specific chymase as the major angiotensin II-forming enzyme in the human heart. J Biol Chem 1990;265:22348-22357.[Abstract/Free Full Text]
  9. Padmanabhan N., Jardine A.G., McGrath J.C., Connell J.M. Angiotensin-converting enzyme-independent contraction to angiotensin I in human resistance arteries. Circulation 1999;99:2914-2920.[Abstract/Free Full Text]
  10. Royston D., Bidstrup B.P., Taylor K.M., Sapsford R.N. Effect of aprotinin on need for blood transfusion after repeat open-heart surgery. Lancet 1987;2:1289-1291.[Medline]
  11. Hubert C., Houot A.M., Corvol P., Soubrier F. Structure of the angiotensin I- converting enzyme gene. Two alternate promoters correspond to evolutionary steps of a duplicated gene. J Biol Chem 1991;266:15377-15383.[Abstract/Free Full Text]
  12. Urata H., Kinoshita A., Perez D.M., et al. Cloning of the gene and cDNA for human heart chymase. J Biol Chem 1991;266:17173-17179.[Abstract/Free Full Text]
  13. Ponte P., Ng S.Y., Engel J., Gunning P., Kedes L. Evolutionary conservation in the untranslated regions of actin mRNAs: DNA sequence of a human beta-actin cDNA. Nucleic Acids Res 1984;12:1687-1696.[Abstract/Free Full Text]
  14. Major T.C., Overhiser R.W., Taylor D.G., Jr, Panek R.L. Effects of quinapril, a new angiotensin-converting enzyme inhibitor, on vasoconstrictor activity in the isolated, perfused mesenteric vasculature of hypertensive rats. J Pharmacol Exp Ther 1993;265:187-193.[Abstract/Free Full Text]
  15. Yang Z., Oemar B.S., Carrel T., Kipfer B., Julmy F., Lüscher T.F. Different proliferative properties of smooth muscle cells of human arterial and venous bypass vessels. Role of PDGF receptors, mitogen-activated protein kinase, and cyclin-dependent kinase inhibitors. Circulation 1998;97:181-187.[Abstract/Free Full Text]
  16. He G.W., Yang C.Q. Use of verapamil and nitroglycerin solution in preparation of radial artery for coronary grafting. Ann Thorac Surg 1996;61:610-614.[Abstract/Free Full Text]
  17. Urata H., Strobel F., Ganten D. Widespread tissue distribution of human chymase. J Hypertens 1994;12(Suppl):S17-S22.
  18. Borland J.A., Chester A.H., Morrison K.A., Yacoub M.H. Alternative pathways of angiotensin II production in the human saphenous vein. Br J Pharmacol 1998;125:423-428.[Medline]
  19. Voors A.A., Pinto Y.M., Buikema H., et al. Dual pathway for angiotensin II formation in human internal mammary arteries. Br J Pharmacol 1998;125:1028-1032.[Medline]
  20. Okunishi H., Oka Y., Shiota N., Kawamoto T., Song K., Miyazaki M. Marked species-difference in the vascular angiotensin II-forming pathways: humans versus rodents. Jpn J Pharmacol 1993;62:207-210.[Medline]
  21. Wolny A., Clozel J.P., Rein J., et al. Functional and biochemical analysis of angiotensin II-forming pathways in the human heart. Circ Res 1997;80:219-227.[Abstract/Free Full Text]
  22. Okunishi H., Miyazaki M., Okamura T., Toda N. Different distribution of two types of angiotensin II-generating enzymes in the aortic wall. Biochem Biophys Res Commun 1987;149:1186-1192.[Medline]
  23. Kokkonen J.O., Saarinen J., Kovanen P.T. Regulation of local angiotensin II formation in the human heart in the presence of interstitial fluid. Inhibition of chymase by protease inhibitors of interstitial fluid and of angiotensin-converting enzyme by Ang-(1–9) formed by heart carboxypeptidase A-like activity. Circulation 1997;95:1455-1463.[Abstract/Free Full Text]
  24. Strawn W.B., Chappell M.C., Dean R.H., Kivlighn S., Ferrario C.M. Inhibition of early atherogenesis by losartan in monkeys with diet-induced hypercholesterolemia. Circulation 2000;101:1586-1593.[Abstract/Free Full Text]
  25. Schiffrin E.L., Park J.B., Intengan H.D., Touyz R.M. Correction of arterial structure and endothelial dysfunction in human essential hypertension by the angiotensin receptor antagonist losartan. Circulation 2000;101:1653-1669.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Eur. J. Cardiothorac. Surg.Home page
M. J. Shackcloth, A. R. Conant, J. Thekkudan, S. Ghotkar, A. W.M. Simpson, and W. C. Dihmis
Attenuation of receptor-dependent and -independent vasoconstriction in the human radial artery
Eur. J. Cardiothorac. Surg., October 1, 2008; 34(4): 839 - 844.
[Abstract] [Full Text] [PDF]

Home page
 Ann. Thorac. Surg.Home page
S. Attaran, L. John, and A. El-Gamel
Clinical and Potential Use of Pharmacological Agents to Reduce Radial Artery Spasm in Coronary Artery Surgery
Ann. Thorac. Surg., April 1, 2008; 85(4): 1483 - 1489.
[Abstract] [Full Text] [PDF]

Home page
 Cardiovasc ResHome page
S. A Doggrell and J. C Wanstall
Vascular chymase: pathophysiological role and therapeutic potential of inhibition
Cardiovasc Res, March 1, 2004; 61(4): 653 - 662.
[Abstract] [Full Text] [PDF]

Home page
 Eur. J. Cardiothorac. Surg.Home page
O. Mangoush, K. Nakamura, S. Al-Ruzzeh, T. Athanasiou, A. Chester, and M. Amrani
Effect of ascorbic acid on endothelium-dependent vasodilatation of human arterial conduits for coronary artery bypass grafting
Eur. J. Cardiothorac. Surg., October 1, 2003; 24(4): 541 - 546.
[Abstract] [Full Text] [PDF]

Home page
 Ann. Thorac. Surg.Home page
K. Nakamura, S. Al-Ruzzeh, A. H. Chester, I. Schmidt, M. Barbir, M. H. Yacoub, and M. Amrani
Effects of cerivastatin on vascular function of human radial and left internal thoracic arteries
Ann. Thorac. Surg., June 1, 2002; 73(6): 1860 - 1865.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Personal Folders
Right arrow Download to citation manager
Right arrow Author home page(s):
Magdi H. Yacoub
Right arrow Permission Requests
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Borland, J. A.A.
Right arrow Articles by Yacoub, M. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Borland, J. A.A.
Right arrow Articles by Yacoub, M. H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ANN THORAC SURG ASIAN CARDIOVASC THORAC ANN EUR J CARDIOTHORAC SURG
J THORAC CARDIOVASC SURG ICVTS ALL CTSNet JOURNALS