ATS
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Personal Folders
Right arrow Download to citation manager
Right arrow Author home page(s):
David R. Jones
Right arrow Permission Requests
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jones, D. R.
Right arrow Articles by Mayo, M. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jones, D. R.
Right arrow Articles by Mayo, M. W.
Related Collections
Right arrowRelated Article

Ann Thorac Surg 2000;70:930-936
© 2000 The Society of Thoracic Surgeons


Original articles: general thoracic

Inhibition of NF-{kappa}B sensitizes non–small cell lung cancer cells to chemotherapy-induced apoptosis

David R. Jones, MDa,b, R. Michael Broad, PhDa, Lee V. Madrid, BSb, Albert S. Baldwin, Jr, PhDb, Marty W. Mayo, PhDb

a Department of Surgery, The University of Virginia, Charlottesville, Virginia, USA
b Department of Biology, The University of North Carolina, Chapel Hill, North Carolina, USA

Address reprint requests to Dr Jones, Thoracic and Cardiovascular Surgery, University of Virginia, PO Box 800679, Charlottesville, VA 22908-0679
e-mail: djones{at}virginia.edu

Presented at the Thirty-sixth Annual Meeting of The Society of Thoracic Surgeons, Ft Lauderdale, FL, Jan 31–Feb 2, 2000.


    Abstract
 Top
 Abstract
 Introduction
 Material and methods
 Results
 Comment
 References
 
Background. Most non–small cell lung cancers (NSCLC) are chemoresistant. Identification and modulation of chemoresistance cell-signaling pathways may sensitize NSCLC to chemotherapy and improve patient outcome. The purpose of this study was to determine if chemotherapy induces nuclear factor-kappa B (NF-{kappa}B) activation in NSCLC in vitro and whether inhibition of NF-{kappa}B would sensitize tumor cells to undergo chemotherapy-induced apoptosis.

Methods. Non–small cell lung cancer cells were treated with gemcitabine, harvested, and nuclear extracts analyzed for NF-{kappa}B DNA binding by electrophoretic mobility shift assays. Additionally, NSCLC cells that stably expressed a plasmid encoding the superrepressor I{kappa}B{alpha} protein (H157I) or a vector control (H157V) were generated. These cells were then treated with gemcitabine and apoptosis determined by terminal deoxynucleotidyl transferase mediated nick end labeling (TUNEL) assay.

Results. Chemotherapy induced NF-{kappa}B nuclear translocation and DNA binding in all NSCLC cell lines. H157I cells had enhanced cell death compared with H157V cells, suggesting that NF-{kappa}B is required for cell survival after chemotherapy. The observed cell death following the loss of NF-{kappa}B occurred by apoptosis.

Conclusions. Inhibition of chemotherapy-induced NF-{kappa}B activation sensitizes NSCLC to chemotherapy-induced apoptosis in vitro. Novel treatment strategies for patients with advanced NSCLC may involve chemotherapy combined with inhibition of NF-{kappa}B-dependent cell-survival pathways.


    Introduction
 Top
 Abstract
 Introduction
 Material and methods
 Results
 Comment
 References
 
The projected number of new cases of lung cancer in 1999 in the United States is 171,600, with more than 158,000 people dying from the disease during the same year [1]. Lung cancer remains the most common cause of cancer death in both men and women. In fact, more people die each year from lung cancer than from breast, colorectal, prostate, and ovarian malignancies combined [1].

Eighty percent of all newly diagnosed lung cancers are non–small cell lung cancers (NSCLC), and more than 75% present late with stage III or IV disease [2]. Additionally, in patients who undergo complete resection of a stage I or II NSCLC, two thirds of the first recurrences will be distant [3]. Because of this advanced stage at presentation in patients with NSCLC and a predilection for distant recurrences after surgery, chemotherapy alone or in combination with surgery or radiation is a common treatment strategy. Chemotherapy is also included in most induction therapy protocols, which are designed to "downstage" NSCLC, thus potentially improving resectability rates.

The advent of new third-generation chemotherapeutic agents has created a cautious wave of optimism for patients with advanced stage NSCLC [4]. Unfortunately, in patients with NSCLC treated with single agent or combination third-generation chemotherapeutic agents, the partial response rates are only 30% to 55%. Complete response rates are very uncommon [4, 5]. Thus, most NSCLCs remain chemoresistant.

The problem of chemoresistance in NSCLC has been complicated by a significant lack of understanding of the cell-signaling mechanisms involved in chemotherapy-induced cell death. Tumor chemoresistance has been associated with a number of factors including amplification of the MDRP1 P-glycoprotein, mutated p53, overexpression of glutathione S-transferase, DNA repair enzymes, Bcl-2 family members, and various oncogenes [6].

More recently, chemoresistance in selected tumors has been linked to the activation of an antiapoptotic transcription factor, nuclear factor-kappa B (NF-{kappa}B) [7, 8]. NF-{kappa}B is an inducible member of the Rel family of transcription factors of which there are presently five known proteins: c-Rel, p50, p65, p52, and RelB [9]. All of these proteins contain the Rel homology domain, which is responsible for dimerization, DNA binding, and interactions with I{kappa}B-like molecules. Classic NF-{kappa}B is a heterodimer composed of p50 and p65. NF-{kappa}B is maintained in the cytoplasm where it is inactive, through an interaction of the p65 or c-Rel subunit with the inhibitor protein, I{kappa}B [9, 10]. NF-{kappa}B is activated by cytokines, {gamma}-irradiation, and certain chemotherapeutic agents that subsequently lead to the phosphorylation, ubiquitination, and proteosome-mediated degradation of I{kappa}B [9, 11, 12]. Once NF-{kappa}B dissociates from I{kappa} 66 it translocates to the nucleus, where it transcriptionally upregulates antiapoptotic and other gene products. The recent discovery of phosphorylation sites, required for proteosome-mediated degradation of I{kappa}B and subsequent nuclear translocation of NF-{kappa}B, facilitated the generation of a superrepressor mutant of I{kappa}B{alpha} (I{kappa}B{alpha}-SR) [13]. I{kappa}B{alpha}-SR cannot be phosphorylated or degraded and, as a result, acts as a dominant-negative repressor to selectively inhibit NF-{kappa}B nuclear translocation, and therefore transcription, in response to cellular stimulation [13].

The purpose of this study was to determine whether NF-{kappa}B is activated in vitro by chemotherapy in human NSCLC. The chemotherapeutic agent used in this study was gemcitabine, a third-generation cytidine analogue that has been shown to have response rates of approximately 40% in NSCLC [4, 14]. Secondly, we wanted to determine whether NF-{kappa}B is required for cell survival following the addition of chemotherapy. Finally, we wanted to ascertain whether the loss of NF-{kappa}B sensitizes NSCLC cells to chemotherapy and whether the resulting cell death occurs by apoptosis.


    Material and methods
 Top
 Abstract
 Introduction
 Material and methods
 Results
 Comment
 References
 
Cell culture
The human NSCLC cell lines (NCI-H157, H358, and H460; American Type Culture Collection, Manassas, VA) were incubated at 37°C in RPMI 1640 media, supplemented with 10% fetal bovine serum and antibiotics (Life Technologies, Rockville, MD). Cells were cultured to 100% confluency, trypsinized, and plated at a seeding density of 2 x 106 per 100-mm dish.

Measurement of chemotherapy-induced NF-{kappa}B nuclear translocation
Twenty-four hours later the H157, H358, and H460 cells were 60% to 70% confluent and were either not treated or exposed to gemcitabine (1 µmol/L) (Eli Lilly and Company, Indianapolis, IN). This dose of gemcitabine was chosen as it closely reflects human serum levels [14]. Cells were harvested before (T0) or after the addition of gemcitabine at 2, 4, 6, and 8 hours. As a positive control cells were treated for 15 minutes with tumor necrosis factor (TNF; 10 ng/mL per plate) (Roche Diagnostics, Indianapolis, IN), a known activator of NF-{kappa}B [9, 12].

Nuclear extracts were prepared for the above experimental conditions. Briefly, cells were washed twice with ice-cold phosphate-buffered saline, scraped gently from the plates, transferred to microcentrifuge tubes, and lysed on ice in three pellet volumes of cytoplasmic extraction buffer (10 mmol/L HEPES [pH 7.6], 60 mmol/L KCl, 1 mmol/L EDTA (ethylenediaminetetraacetic acid), 0.1% Nonidet p-40, 1 mmol/L dithiothreitol, 1 mmol/L phenylmethylsulfonyl fluoride, and 1 µg each of aprotinin, leupeptin, and pepstatin per milliliter). Nuclei were pelleted (1,800 x g, 4°C, 5 minutes), and maintained on ice. Nuclei were washed gently with 100 µL of cytoplasmic extraction buffer without Nonidet P-40 and pelleted (1,800 x g, 4°C, 5 minutes), and the supernatants were discarded. Two pellet volumes of nuclear extraction buffer (20 mmol/L Tris [pH 8.0], 420 mmol/L NaCl, 1.5 mmol/L MgCl2, 0.2 mmol/L EDTA, 0.5 mmol/L phenylmethylsulfonyl fluoride, 25% glycerol, and 1.0 µg each of aprotinin, leupeptin, and pepstatin per milliliter) were added, and the final salt concentration was adjusted to 400 mmol/L with 2.5 mol/L NaCl. Nuclear pellets were resuspended by vortexing and incubated on ice for 10 minutes. Finally, nuclear extracts were cleared (16,000 x g, 4°C, 10 minutes) and transferred to fresh tubes. Protein concentrations were determined by the Bradford assay using the Bio-Rad protein assay dye reagent (Bio-Rad Laboratories, Hercules, CA), and all nuclear extracts stored at -70°C.

NF-{kappa}B nuclear translocation was determined by electrophoretic mobility shift assay (EMSA) analysis. Equal amounts of nuclear extracts (8 µg) were incubated in a total volume of 20 µL of binding buffer for 20 minutes at room temperature with a [32P]-labeled double-stranded probe containing a {kappa}B consensus site (underlined) from the class I major histocompatibility complex promoter (5'CAGGGCTGGGGATTCCCCATCTCCACAGTTTCACTTC3'). The binding buffer consisted of 10 mmol/L Tris (pH 7.7), 50 mmol/L NaCl, 0.5 mmol/L EDTA, 1 mmol/L dithiothreitol, 10% glycerol, and 1 µg of poly(dI-dC)-poly(dI-dC) (Pharmacia Biotech, Piscataway, NJ). DNA-protein complexes were separated on 5% polyacrylamide gels in Tris-glycine buffer (25 mmol/L Tris, 190 mmol/L glycine, and 1 mmol/L EDTA), dried, and underwent autoradiography.

For supershift experiments, 2 µg of rabbit polyclonal antibodies against the p50 subunit (NLS; Santa Cruz Biotechnology, Santa Cruz, CA) or the p65 subunit (Rockland, Gilbertsville, PA) of NF-{kappa}B were incubated with the nuclear extracts 10 minutes before the addition of the [32P]-labeled probe and then analyzed as described above. Addition of the p50 antibody to the nuclear localization sequence results in no demonstrable NF-{kappa}B DNA binding while addition of the p65 antibody results in a gel shift of the p65 protein. Three independent experiments (exclusive of the supershift analysis) were performed for each NSCLC cell line.

Generation of stably expressing dominant-negative NF-{kappa}B cell lines
To better analyze the functional role of chemotherapy-induced NF-{kappa}B activation, generation of a stably transfected NSCLC cell lines was carried out. The H157 NSCLC cell line was chosen to be stably transfected with a plasmid encoding the I{kappa}B{alpha}-SR (generously provided by D. Ballard, Vanderbilt University). Briefly, parental H157 cells were cotransfected with either 2 µg of the pCMV-I{kappa}B{alpha} expression plasmid or a vector control plasmid and 0.2 µg of puromycin-N-acetyl transferase DNA utilizing 18 µL of Lipofectamine reagent (Life Technologies) for each sample. Cells were allowed to grow under puromycin selection, and individual clones were subsequently harvested and expanded into cell lines.

Once the cells were of an adequate density, they were harvested in iced phosphate-buffered saline and whole-cell lysates prepared by resuspending cell pellets in ice-cold RIPA buffer (10 mmol/L Tris-HCl [pH 8.0], 1 mmol/L EDTA, 1% sodium dodecyl sulfate, 1% Nonidet P-40). Pellets were incubated on ice for 20 minutes. Supernatant lysates were collected following high-speed centrifugation for 20 minutes at 4°C. Equal amounts of protein extracts (50 µg) were electrophoresed on 10% polyacrylamide-sodium dodecyl sulfate gels and transferred to nitrocellulose membranes (Schleicher & Schuell, Keene, NH). Blocking was performed in 0.5% nonfat dry milk-1 x TBST (25 mmol/L Tris-HCl [pH 8.0], 125 mmol/L NaCl, 0.1% Tween 20). Western blots were analyzed for the expression of I{kappa}B{alpha} using an I{kappa}B{alpha}-specific primary antibody (C21, Santa Cruz Biotechnology), horseradish peroxidase-conjugated anti-rabbit secondary antibody, followed by enhanced chemiluminescence (Amersham, Cleveland, OH). Clones expressing the I{kappa}B{alpha}-SR were renamed H157I while the vector control cells were renamed H157V. To confirm that the I{kappa}B{alpha}-SR protein was functional EMSA analysis was performed in the absence or presence of gemcitabine (1 µmol/L).

Measurement of apoptosis
The H157 I and H157V cells (1 x 105 cells/well) were plated on glass cover slips and allowed to adhere overnight. Eighteen hours later cells were treated with gemcitabine (1 to 10 µmol/L) and incubated at 37°C. Cells were fixed in 4% paraformaldehyde 48 hours after gemcitabine treatment and TUNEL analysis performed (Roche Diagnostics). Cells were also exposed to ultraviolet irradiation, a known inducer of apoptosis, as a positive control. Apoptosis was identified on phase-shift microscopy by the typical morphologic changes of membrane blebbing, condensation, and nuclear fragmentation. TUNEL-positive cells were observed as fluorescein isothiocyanate-labeled bodies on the fluorescent microscope. Apoptosis was quantitated by counting the number of apoptotic cells in five separate fields and reported as the average percent of apoptotic cells ± SEM. The experiment was repeated three times with two replicates per experiment. Data were analyzed for significance using analysis of variance followed by Bonferroni’s multiple comparisons test. Statistical significance was set at p less than 0.05.


    Results
 Top
 Abstract
 Introduction
 Material and methods
 Results
 Comment
 References
 
Chemotherapy induces NF-{kappa}B nuclear translocation
The addition of gemcitabine to NSCLC cell lines in vitro induced NF-{kappa}B DNA-binding activity, as compared with nuclear extracts from unstimulated cells (Fig 1). The ability of gemcitabine to stimulate NF-{kappa}B activation was not cell line-specific, because similar results were also obtained using additional NSCLC cell lines (NCI-125, NCI-A549, data not shown). Gemcitabine-induced NF-{kappa}B nuclear translocation and DNA-binding was not as robust as that induced by the cytokine TNF.



View larger version (61K):
[in this window]
[in a new window]
 
Fig 1. Electrophoretic mobility gel shift assay demonstrating increased nuclear translocation and DNA binding of nuclear factor-kappa B (NF-{kappa}B). Experiments included H157, H358, and H460 non–small cell lung cancer cells treated with gemcitabine for 3 hours compared with untreated cells. Tumor necrosis factor (TNF) was used as a positive control for all experiments.

 
The time course of gemcitabine-induced NF-{kappa}B activation shows that maximal NF-{kappa}B nuclear translocation occurred 4 to 8 hours following the addition of gemcitabine (Fig 2). Gel-shift analysis of NF-{kappa}B activation at time points earlier than 2 hours showed little NF-{kappa}B DNA-binding (data not shown). Supershift analysis of the protein/DNA complexes using antibodies specific for either the p65 or p50 subunit of NF-{kappa}B confirmed that the nuclear proteins identified by EMSA were composed of the "classic" NF-{kappa}B heterodimer.



View larger version (98K):
[in this window]
[in a new window]
 
Fig 2. The time course of nuclear factor-kappa B (NF-{kappa}B) activation in H157 cells as shown by electrophoretic mobility gel shift assay (EMSA) demonstrating that maximal activation occurs hours after exposure to chemotherapy. As described in the Material and Methods section, addition of the p50 and p65 antibodies to the nuclear extracts confirms that the bands identified on EMSA are NF-{kappa}B.

 
Generation of dominant-negative NF-{kappa}B cell lines
Using the above noted methodology, the H157 cell line was stably transfected with the I{kappa}B{alpha}-SR, which acts as a dominant-negative suppressor of NF-{kappa}B activation. As shown in Figure 3A, an isolated clone of H157 NSCLC cells clearly overexpressed the I{kappa}B{alpha}-SR compared with the parental and vector control cell lines. The clone of cells expressing the I{kappa}B{alpha}-SR protein was renamed H157I, whereas that expressing the vector control was renamed H157V.



View larger version (54K):
[in this window]
[in a new window]
 
Fig 3. (A) Total protein was isolated from H157 parental cells, and from stably transfected cell lines expressing either the empty vector control (H157V) or cells expressing the I{kappa}B{alpha}-SR (H157I). Note that the flag-tagged I{kappa}B{alpha}-SR protein migrates with a slightly slower mobility than the endogenous I{kappa}B{alpha}. (B) Electrophoretic mobility gel shift assay was carried out using H157V and H157I cell nuclear extracts after treatment with 1 µmol/L gemcitabine. Note that expression of the I{kappa}B{alpha}-SR in the H157I cells effectively blocks nuclear factor-kappa B (NF-{kappa}B) nuclear translocation.

 
To determine if the H157I cells could effectively abrogate chemotherapy-induced NF-{kappa}B activation, these cells, along with the H157V cells, were treated with gemcitabine, then nuclear extracts were isolated and EMSAs were carried out. The H157I cells had no induction of NF-{kappa}B nuclear translocation after treatment with gemcitabine whereas the H157V cells had the expected NF-{kappa}B nuclear translocation following chemotherapy (Fig 3B). This inhibition of chemotherapy-induced NF-{kappa}B activation in the H157I cells demonstrated conclusively that overexpression of the I{kappa}B{alpha}-SR functioned as a dominant-negative repressor of NF-{kappa}B.

Inhibition of NF-{kappa}B chemosensitizes non–small cell lung cancer cells
To determine the effect of inhibition of NF-{kappa}B activation on chemotherapy-induced cell death, H157I and H157V cells were incubated with varying concentrations of gemcitabine and cell death rates evaluated. As shown in Figure 4, the H157I cells were markedly more chemosensitive than the vector control cell line, H157V. Maximal tumor cell death occurred with 1-µmol/L concentrations of gemcitabine (same dose used to induce NF-{kappa}B activation) although concentrations 100x lower killed more cells in the H157I cell line compared with the vector control at the same time point postchemotherapy. Tumor cell death as determined by cell count began to occur as early as 18 to 24 hours after chemotherapy and appeared to be maximal by 72 hours.



View larger version (96K):
[in this window]
[in a new window]
 
Fig 4. Photomicrograph of H157V and H157I cells 72 hours after treatment with different concentrations of gemcitabine. (20x before 51% reduction.)

 
Chemotherapy-induced cell death after NF-{kappa}B inhibition occurs by apoptosis
To determine if the loss in cell number seen in the H157I cells could be attributed to an apoptotic process, cells were exposed to gemcitabine and TUNEL analysis performed. Figure 5 suggests strongly that the cell death in the H157I cell line is occurring through an apoptotic process, whereas the H157V cells remain relatively chemoresistant, as shown previously in Figure 4.



View larger version (77K):
[in this window]
[in a new window]
 
Fig 5. TUNEL analysis of H157I and H157V cells confirming that the decreased cell number observed in H157I cells after chemotherapy (Fig 4) is the result of apoptotic cell death. The number in the lower right corner is the average percentage of apoptotic cells observed microscopically in five different fields.

 
The fraction of apoptotic cells was quantitated by counting apoptotic cells in both the H157I and H157V cells after treatment with gemcitabine (Fig 6). The fraction of apoptotic cells increased significantly in the H157I cells at all time points compared with the H157V cells (p < 0.01). As demonstrated, at 72 hours after chemotherapy almost 90% of tumor cells were apoptotic in the H157I cell line compared with only 32% of the H157V cells.



View larger version (22K):
[in this window]
[in a new window]
 
Fig 6. A bar graph showing that, in the absence of nuclear factor-kappa B (NF-{kappa}B), H157I cells are sensitized to gemcitabine-induced cell death at all time points compared with H157V cells, which have functional NF-{kappa}B activity. (*p < 0.001, {dagger}p < 0.01.)

 

    Comment
 Top
 Abstract
 Introduction
 Material and methods
 Results
 Comment
 References
 
Despite treatment advances in a number of solid tumor malignancies, including breast, prostate, and colorectal tumors, the 5-year survival for all patients with lung cancer remains at 14%, which is relatively unchanged over the past 25 years. Treatment strategies for patients with lung cancer have evolved gradually from single to multimodality therapy, of which nearly every protocol includes induction or adjuvant chemotherapy [4]. The past decade has seen new chemotherapeutic agents that have improved response rates in NSCLC compared with older regimens.

Since its discovery in 1986 by Baltimore, NF-{kappa}B increasingly has been shown to be involved in inflammatory and cytokine-mediated cell processes [9, 15, 16]. Recently, several studies have established that genotoxic stressors such as chemotherapy can induce NF-{kappa}B activation [7, 11]. Etoposide, CPT-11, Adriamycin, vinca alkaloids, and Taxol have all been shown to activate NF-{kappa}B [7, 11, 17]. Once activated by chemotherapy, NF-{kappa}B has been shown to provide an antiapoptotic function by promoting cell survival of fibrosarcoma and colorectal carcinoma cell lines [7, 17]. In an effort to better understand the cell-signaling pathways involved in chemoresistance in NSCLC, our laboratory has been exploring the antiapoptotic role of NF-{kappa}B in overcoming chemotherapy-mediated cell death.

This study established clearly that clinical doses of gemcitabine induce NF-{kappa}B activation in several different NSCLC cell lines in vitro. Subsequently we have performed EMSA experiments using other chemotherapeutic agents commonly used to treat NSCLC tumors, including cisplatin and CPT-11. We have found that the addition of these agents results in NF-{kappa}B activation in those NSCLC cell lines evaluated. These results suggest that the observations described herein are not chemotherapeutic agent specific. Combination chemotherapy experiments are currently being performed to determine if there may be a synergistic effect on NF-{kappa}B activation.

In contrast to TNF-induced NF-{kappa}B activation, which occurs in minutes [9, 10], chemotherapy appears to activate NF-{kappa}B much later (hours) in our cell lines. This observed time course of chemotherapy-induced NF-{kappa}B activation is supported by other studies [17], and suggests that cell signals upstream of NF-{kappa}B activation may be different for chemotherapy and cytokine-induced NF-{kappa}B activation. Cytokine-induced NF-{kappa}B activation occurs by recently identified kinases (IKK1 and 2) that phosphorylate serines 32 and 36 on I{kappa}B{alpha}, initiating ubiquitination and proteosome degradation of I{kappa}B proteins [18]. It is unclear whether chemotherapy-induced NF-{kappa}B activation occurs through the same signaling pathway, although our observation of a difference in the time course of NF-{kappa}B activation suggests different pathways.

To establish whether NF-{kappa}B was required or necessary for cell survival following chemotherapy in NSCLC, we were able to effectively inhibit NF-{kappa}B activation by generating cell lines that stably expressed a dominant-negative repressor of NF-{kappa}B. Expression of the dominant-negative protein in the H157I cell line was confirmed by Western blot analysis. The ability of the I{kappa}B{alpha}-SR protein to inhibit chemotherapy-induced NF-{kappa}B activation was demonstrated by EMSA. As shown in Figure 4, when NF-{kappa}B activation was inhibited completely, the tumor cells were markedly sensitized to chemotherapy. This finding suggests that NF-{kappa}B activation provides a cell survival signal following chemotherapy. Our laboratory, and others, have recently begun to dissect which antiapoptotic gene products are regulated by NF-{kappa}B [8, 19]. Members of the inhibitors of apoptosis protein family, c-IAP-1 and c-IAP-2, as well as A1, a Bcl-2 homologue, are now known to be transcriptionally regulated by NF-{kappa}B. It is thought that upregulation of these proteins, as well as others, can rescue chemotherapy-mediated cell death by inhibition of specific components of the caspase cascade [19]. NF-{kappa}B may also have an important antiapoptotic role by controlling cell growth and differentiation through transcriptional regulation of cyclin D1 [20]. Finally, NF-{kappa}B activation has been shown to be involved in oncogenesis induced by oncogenic Ras by suppressing p53-independent apoptosis [21].

Cell death occurs through two different and sometimes additive processes, necrosis and apoptosis. The decrease in cell number observed in the H157I compared with the H157V cells may have occurred secondary to cell growth inhibition or necrotic cell death. As shown in Figures 5 and 6, the decrease in cell number in the absence of NF-{kappa}B (H157I) after treatment with chemotherapy was secondary to apoptotic cell death. There were significantly more apoptotic cells in the absence of NF-{kappa}B (H157I) compared with cells that had functional NF-{kappa}B activity (H157V). This finding suggests that chemotherapy-mediated cell death in the absence of NF-{kappa}B may occur by activation of the caspase cascade, which results in apoptosis. Other studies have confirmed that chemotherapy kills tumor cells by caspase activation [22, 23]. We did not specifically evaluate chemotherapy-induced caspase activation in this study, but have preliminary evidence that the mechanism of chemotherapy-induced cell death in NSCLC cells lacking functional NF-{kappa}B does not involve activation of the cell membrane death receptor Fas, a known activator of the caspase cascade [24].

A limitation of this study was that the experiments performed to date were in transformed cell lines that do not have the same growth characteristics as the original tumor and thus only approximate in vivo controls. Unfortunately, primary tumor cell cultures rarely survive and therefore are not available for analysis. It is not uncommon for cell-signaling studies such as this one to begin with in vitro experiments using transformed cell lines and then progress to in vivo experimentation.

Our observations of chemotherapy-induced NF-{kappa}B activation and the resulting chemosensitization when NF-{kappa}B is inhibited, demonstrate that activation of NF-{kappa}B is a novel mechanism of chemoresistance in NSCLC. Mukhopadhyay and colleagues [25] demonstrated increased expression of the p50 subunit of NF-{kappa}B in 80% of fresh human NSCLC tissues compared with normal adjacent lung tissue. This observation, coupled with our identification of basal levels of NF-{kappa}B in our NSCLC cell lines, suggests that NSCLC may have altered levels of NF-{kappa}B de novo, which when activated by chemotherapy, provide a tumor cell survival function. This study’s finding that inhibition of NF-{kappa}B resulted in significant chemosensitization in our NSCLC cell line suggests that NF-{kappa}B is a good cancer drug target. There are several different strategies to inhibit NF-{kappa}B activation, including the administration of proteosome-specific protease inhibitors such as MG132, PS-341, aprotinin, or treatment with various antioxidants such as N-acetylcysteine and PDTC [26]. Other substances that have been shown directly or indirectly to block NF-{kappa}B activation include TGF-ß1, Tosylphenylalanyl chloromethyl ketone (TPCK) a serine/threonine protease inhibitor, and steroids [26]. Finally, our laboratory and others have been able to introduce the I{kappa}B{alpha}-SR protein into tumor cells though adenoviral-mediated gene delivery and have observed a similar cytotoxic response to TNF and chemotherapy [17, 27].

In conclusion, this study has demonstrated that chemotherapy induces NF-{kappa}B activation in NSCLC in vitro, which is required for cell survival after chemotherapy. More importantly, inhibition of this chemotherapy-induced NF-{kappa}B activation significantly chemosensitizes the NSCLC cells to die by apoptosis. Thus, cell-signaling pathways involving NF-{kappa}B activation are likely to be an important mechanism of chemoresistance in NSCLC. Although future in vivo studies are needed to confirm our findings, these preliminary results have identified NF-{kappa}B as a potential molecular target for novel pharmaceuticals or gene therapy in patients with locoregionally advanced or metastatic NSCLC.


    References
 Top
 Abstract
 Introduction
 Material and methods
 Results
 Comment
 References
 

  1. Landis S.H., Murray T., Bolden S., Wingo P.A. Cancer statistics 1999. CA Cancer J Clin 1999;49:8-31.[Abstract/Free Full Text]
  2. Bülzebruck H., Bopp R., Drings P., et al. New aspects in the staging of lung cancer. Cancer 1992;70:1102-1110.[Medline]
  3. Jones DR, Detterbeck FC. Surgery for stage I disease. In: Detterbeck FC, ed. Diagnosis and treatment of lung cancer: an evidence-based guide for the clinician. Philadelphia: WB Saunders, 2000; in press.
  4. Bunn P.A., Jr, Kelly K. New chemotherapeutic agents prolong survival and improve quality of life in non-small cell lung cancer. Clin Cancer Res 1998;5:1087-1100.
  5. Non-Small Cell Lung Cancer Collaborative Group. Chemotherapy in non-small cell lung cancer. Br Med J 1995;311:899-909.[Abstract/Free Full Text]
  6. El-Deiry W.S. Role of oncogenes in resistance and killing by cancer. Curr Opin Oncol 1997;9:79-87.[Medline]
  7. Wang C.Y., Mayo M.W., Baldwin A.S., Jr TNF-and cancer therapy-induced apoptosis. Science 1996;274:784-787.[Abstract/Free Full Text]
  8. Wang C.Y., Mayo M.W., Korneluk R.G., Goeddel D.V., Baldwin A.S. NF-{kappa}B antiapoptosis. Science 1998;281:1680-1683.[Abstract/Free Full Text]
  9. Baldwin A.S., Jr The NF-{kappa}B and I{kappa}B proteins. Ann Rev Immunol 1996;14:649-681.[Medline]
  10. Whiteside S.T., Israel A. I{kappa}B proteins. Cancer Biol 1999;8:75-82.
  11. Das K.C., White C.W. Activation of NF-{kappa}B by antineoplastic agents. J Biol Chem 1997;272:14914-14920.[Abstract/Free Full Text]
  12. Blackwell T.S., Christman J.W. The role of nuclear factor-{kappa}B in cytokine gene regulation. Am J Respir Cell Mol Biol 1997;17:3-9.[Abstract/Free Full Text]
  13. Brockman J.A., Scherer D.C., McKinsey T.A., et al. Coupling of a signal response domain in I kappa B alpha to multiple pathways for NF-kappa B activation. Mol Cell Biol 1995;15:2809-2818.[Abstract]
  14. Hui Y.F., Reitz J. Gemcitabine. Am J Health Syst Pharm 1997;54:162-170.[Abstract/Free Full Text]
  15. Sen R., Baltimore D. Multiple nuclear factors interact with the immunoglobulin enhancer sequences. Cell 1986;46:705-716.[Medline]
  16. May M.J., Ghosh S. Rel/NF-{kappa}B/I{kappa}B proteins. Cancer Biol 1997;8:63-73.
  17. Wang C.Y., Cusack J.C., Jr, Liu R., Baldwin A.S., Jr Control of inducible chemoresistance. Nature Med 1999;5:412-417.[Medline]
  18. Mercurio F., Zhu H., Murray B.W., et al. IKK-1, and IKK-2. Cytokine-activated I{kappa}B kinases essential for NF-{kappa}B activation. Science 1997;278:860-866.[Abstract/Free Full Text]
  19. Wang C.Y., Guttridge D.C., Mayo M.W., Baldwin A.S., Jr NF-{kappa}B induces expression of the Bcl-2 homologue A1/Bfl-1 to preferentially suppress chemotherapy-induced apoptosis. Mol Cell Biol 1999;19:5923-5929.[Abstract/Free Full Text]
  20. Guttridge D.C., Albanese C., Reuther J.Y., Pestell R.G., Baldwin A.S., Jr NF-{kappa}B controls cell growth and differentiation through transcriptional regulation of cyclin D1. Mol Cell Biol 1999;19:5785-5799.[Abstract/Free Full Text]
  21. Mayo M.W., Wang C.Y., Cogswell P.C., et al. Requirement of NF-{kappa}B activation to suppress p53-independent apoptosis induced by oncogenic ras. Science 1997;278:1812-1815.[Abstract/Free Full Text]
  22. Sellers W.R., Fisher D.E. Apoptosis and cancer drug targeting. J Clin Invest 1999;104:1655-1661.[Medline]
  23. Guchelaar H.J., Vermes A., Vermes I., Haanen C. Apoptosis. Pharm World Sci 1997;19:119-125.[Medline]
  24. Jones D.R., Mayo M.W., Marshall A., Baldwin A.S., Jr Chemosensitivity in non-small cell lung cancer by NF-{kappa}B inhibition is Fas independent. Surg Forum 1999:L152-L154.
  25. Mukhopadhyay T., Roth J.A., Maxwell S.A. Altered expression of the p50 subunit of the NF-{kappa}B transcription factor complex in non-small cell lung carcinoma. Oncogene 1995;11:999-1003.[Medline]
  26. Waddick K.G., Uckun F.M. Innovative treatment programs against cancer. Biochem Pharmacol 1999;57:9-17.[Medline]
  27. Batra R.K., Guttridge D.C., Brenner D.A., Dubinett S.M., Baldwin A.S., Jr, Boucher R.C. I{kappa}B{alpha} gene transfer is cytotoxic to squamous-cell lung cancer cells and sensitizes them to tumor necrosis factor-{alpha}-mediated cell death. Am J Respir Cell Mol Biol 1999;21:238-245.[Abstract/Free Full Text]

Related Article

Discussion
Ann. Thorac. Surg. 2000 70: 936. [Extract] [Full Text] [PDF]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
G. W. Tew, E. L. Lorimer, T. J. Berg, H. Zhi, R. Li, and C. L. Williams
SmgGDS Regulates Cell Proliferation, Migration, and NF-{kappa}B Transcriptional Activity in Non-small Cell Lung Carcinoma
J. Biol. Chem., January 11, 2008; 283(2): 963 - 976.
[Abstract] [Full Text] [PDF]


Home page
haematolHome page
E. Colado, S. Alvarez-Fernandez, P. Maiso, J. Martin-Sanchez, M. B. Vidriales, M. Garayoa, E. M. Ocio, J. C. Montero, A. Pandiella, and J. F. San Miguel
The effect of the proteasome inhibitor bortezomib on acute myeloid leukemia cells and drug resistance associated with the CD34+ immature phenotype
Haematologica, January 1, 2008; 93(1): 57 - 66.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Y. Liu, P. W. Smith, and D. R. Jones
Breast Cancer Metastasis Suppressor 1 Functions as a Corepressor by Enhancing Histone Deacetylase 1-Mediated Deacetylation of RelA/p65 and Promoting Apoptosis
Mol. Cell. Biol., December 1, 2006; 26(23): 8683 - 8696.
[Abstract] [Full Text] [PDF]


Home page
Integr Cancer TherHome page
M. F. McCarty and K. I. Block
Preadministration of High-Dose Salicylates, Suppressors of NF-{kappa}B Activation, May Increase the Chemosensitivity of Many Cancers: An Example of Proapoptotic Signal Modulation Therapy
Integr Cancer Ther, September 1, 2006; 5(3): 252 - 268.
[Abstract] [PDF]


Home page
Toxicol SciHome page
J. Xie and Z. A. Shaikh
Cadmium-Induced Apoptosis in Rat Kidney Epithelial Cells Involves Decrease in Nuclear Factor-Kappa B Activity
Toxicol. Sci., May 1, 2006; 91(1): 299 - 308.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
G. T. Stathopoulos, Z. Zhu, M. B. Everhart, I. Kalomenidis, W. E. Lawson, S. Bilaceroglu, T. E. Peterson, D. Mitchell, F. E. Yull, R. W. Light, et al.
Nuclear Factor-{kappa}B Affects Tumor Progression in a Mouse Model of Malignant Pleural Effusion
Am. J. Respir. Cell Mol. Biol., February 1, 2006; 34(2): 142 - 150.
[Abstract] [Full Text] [PDF]


Home page
J. Thorac. Cardiovasc. Surg.Home page
C. E. Denlinger, B. K. Rundall, and D. R. Jones
Inhibition of phosphatidylinositol 3-kinase/Akt and histone deacetylase activity induces apoptosis in non-small cell lung cancer in vitro and in vivo
J. Thorac. Cardiovasc. Surg., November 1, 2005; 130(5): 1422 - 1429.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
J. Tsurutani, S.S. Castillo, J. Brognard, C. A. Granville, C. Zhang, J. J. Gills, J. Sayyah, and P. A. Dennis
Tobacco components stimulate Akt-dependent proliferation and NF{kappa}B-dependent survival in lung cancer cells
Carcinogenesis, July 1, 2005; 26(7): 1182 - 1195.
[Abstract] [Full Text] [PDF]


Home page
J. Thorac. Cardiovasc. Surg.Home page
C. E. Denlinger, B. K. Rundall, and D. R. Jones
Proteasome inhibition sensitizes non-small cell lung cancer to histone deacetylase inhibitor-induced apoptosis through the generation of reactive oxygen species
J. Thorac. Cardiovasc. Surg., November 1, 2004; 128(5): 740 - 748.
[Abstract] [Full Text] [PDF]


Home page
Ann. Thorac. Surg.Home page
C. E. Denlinger, B. K. Rundall, M. D. Keller, and D. R. Jones
Proteasome Inhibition Sensitizes Non-Small-Cell Lung Cancer to Gemcitabine-Induced Apoptosis
Ann. Thorac. Surg., October 1, 2004; 78(4): 1207 - 1214.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. Guo, U. N. Verma, R. B. Gaynor, E. P. Frenkel, and C. R. Becerra
Enhanced Chemosensitivity to Irinotecan by RNA Interference-Mediated Down-Regulation of the Nuclear Factor-{kappa}B p65 Subunit
Clin. Cancer Res., May 15, 2004; 10(10): 3333 - 3341.
[Abstract] [Full Text] [PDF]


Home page
J. Thorac. Cardiovasc. Surg.Home page
C. E. Denlinger, M. D. Keller, M. W. Mayo, R. M. Broad, and D. R. Jones
Combined proteasome and histone deacetylase inhibition in non-small cell lung cancer
J. Thorac. Cardiovasc. Surg., April 1, 2004; 127(4): 1078 - 1086.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. W. Mayo, C. E. Denlinger, R. M. Broad, F. Yeung, E. T. Reilly, Y. Shi, and D. R. Jones
Ineffectiveness of Histone Deacetylase Inhibitors to Induce Apoptosis Involves the Transcriptional Activation of NF-{kappa}B through the Akt Pathway
J. Biol. Chem., May 23, 2003; 278(21): 18980 - 18989.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. H. Wang, B. J. Manning, Q. D. Wu, S. Blankson, D. Bouchier-Hayes, and H. P. Redmond
Endotoxin/Lipopolysaccharide Activates NF-{kappa}B and Enhances Tumor Cell Adhesion and Invasion Through a {beta}1 Integrin-Dependent Mechanism
J. Immunol., January 15, 2003; 170(2): 795 - 804.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
Y. Xu and M. A. Villalona-Calero
Irinotecan: mechanisms of tumor resistance and novel strategies for modulating its activity
Ann. Onc., December 1, 2002; 13(12): 1841 - 1851.
[Abstract] [Full Text] [PDF]


Home page
J. Thorac. Cardiovasc. Surg.Home page
D. R. Jones, R. M. Broad, L. D. Comeau, S. J. Parsons, and M. W. Mayo
Inhibition of nuclear factor {kappa}B chemosensitizes non-small cell lung cancer through cytochrome c release and caspase activation
J. Thorac. Cardiovasc. Surg., February 1, 2002; 123(2): 310 - 317.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Arlt, J. Vorndamm, S. Muerkoster, H. Yu, W. E. Schmidt, U. R. Folsch, and H. Schafer
Autocrine Production of Interleukin 1{beta} Confers Constitutive Nuclear Factor {kappa}B Activity and Chemoresistance in Pancreatic Carcinoma Cell Lines
Cancer Res., February 1, 2002; 62(3): 910 - 916.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
F. Chen, V. Castranova, and X. Shi
New Insights into the Role of Nuclear Factor-{kappa}B in Cell Growth Regulation
Am. J. Pathol., August 1, 2001; 159(2): 387 - 397.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to Personal Folders
Right arrow Download to citation manager
Right arrow Author home page(s):
David R. Jones
Right arrow Permission Requests
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jones, D. R.
Right arrow Articles by Mayo, M. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jones, D. R.
Right arrow Articles by Mayo, M. W.
Related Collections
Right arrowRelated Article


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
ANN THORAC SURG ASIAN CARDIOVASC THORAC ANN EUR J CARDIOTHORAC SURG
J THORAC CARDIOVASC SURG ICVTS ALL CTSNet JOURNALS