HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Add to Personal Folders Download to citation manager Author home page(s): Anders Jeppsson Christopher G.A. McGregor Permission Requests Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Jeppsson, A. Articles by McGregor, C. G.A. Search for Related Content PubMed PubMed Citation Articles by Jeppsson, A. Articles by McGregor, C. G.A.

Ann Thorac Surg 1998;66:318-324
© 1998 The Society of Thoracic Surgeons

---

Original articles: general thoracic

Transbronchial gene transfer of endothelial nitric oxide synthase to transplanted lungs

^a Department of Surgery, Mayo Clinic and Foundation, Rochester, Minnesota, USA
^b Division of Endocrinology and Metabolism, Mayo Clinic and Foundation, Rochester, Minnesota, USA
^c Department of Physiology and Biophysics, Mayo Clinic and Foundation, Rochester, Minnesota, USA
^d Department of Laboratory Medicine and Pathology, Mayo Clinic and Foundation, Rochester, Minnesota, USA

Address reprint requests to Mr McGregor, Mayo Clinic and Foundation, 200 First St SW, Rochester, MN 55905
e-mail: (mcgregor. christopher{at}mayo.edu)

Presented at the Thirty-fourth Annual Meeting of The Society of Thoracic Surgeons, New Orleans, LA, Jan 26–28, 1998.

	Abstract

Top Abstract Introduction Material and methods Results Comment Acknowledgments References

 
Background. Experiments were designed to study the efficiency, distribution, and toxicity of transbronchial adenoviral-mediated transfer of endothelial constitutive nitric oxide synthase (ecNOS) gene to transplanted lungs.

Methods. Syngeneic orthotopic single-lung transplantation in the rat was performed after airway administration (300 µL, 1 x 10⁹ pfu/mL) of either the ecNOS gene or the marker gene ß-Gal (control group) to donor lungs (n = 4 each). After 4 days, transgene expression, inflammation, and the presence of apoptosis in the transplanted lungs were assessed by molecular, immunohistochemical, and histologic techniques.

Results. Gene transfer was confirmed by a positive polymerase chain reaction signal for the recombinant ecNOS gene, and recombinant messenger RNA by reverse transcription polymerase chain reaction. Positive immunohistochemical staining for ecNOS was present in more than 75% of pneumocytes only in ecNOS transduced lungs. Calcium-dependent nitric oxide synthase activity was increased in ecNOS- compared with ßGal-transduced lungs (2,139 ± 756 versus 47 ± 28 pmol · mg protein^-1 · h^-1; p < 0.05). Minimal to mild inflammation was observed in all transplanted lungs; fewer than 0.5% of cells in both groups were apoptotic.

Conclusions. Transbronchial transfer of ecNOS gene to the transplanted lung results in transduction of pneumocytes with expression of a functionally active transgene product.

	Introduction

Top Abstract Introduction Material and methods Results Comment Acknowledgments References

 
Lung transplantation is an accepted treatment for selected patients with end-stage pulmonary disease. Current 1- and 5-year survival are around 75% and 45%, respectively [1]. The major complication after lung transplantation is obliterative bronchiolitis (OB), which affects more than 50% of patients surviving more than 1 year [1–5]. Obliterative bronchiolitis is characterized by cell proliferation and fibrosis in the terminal airways leading to narrowing and occlusion [2–5]. There is currently no effective treatment for OB. Gene transfer to the transplanted lung may provide an opportunity to affect the development of OB. The feasibility of gene transfer, using marker genes, to the transplanted lung has previously been demonstrated [6–8].

Nitric oxide (NO) has a number of important biologic effects: vasodilation, bronchodilation, and a reduction of smooth muscle cell proliferation, platelet aggregation, and leukocyte adhesion [9]. All of these characteristics may be advantageous to transplanted organs in general and, more specifically, to counteract the process of airway obliteration in lung transplantation. Nitric oxide is synthesized from L-arginine by a group of enzymes, NO synthases (NOSs). Three isoforms of NOS are known, two constitutive (type I and III) and one inducible (type II) [9]. Gene transfer has been used to overexpress type III NOS, endothelial constitutive NOS (ecNOS), in different tissues [10–13] and gene transfer of ecNOS has been shown to increase NO production and reduce smooth muscle cell proliferation in vitro and after carotid injury in rats [11, 14].

Although these studies are promising, gene transfer using adenoviral vectors may incite host immune responses resulting in inflammation [15]. In addition, the transgene product may be toxic, as demonstrated in a recent study in which ecNOS gene transduction caused widespread apoptosis of cardiac myocytes [16].

We therefore designed experiments to study the efficiency, distribution, and toxicity of adenoviral-mediated transfer of ecNOS gene to the transplanted lung with a previously described model of transbronchial gene administration [6].

	Material and methods

Top Abstract Introduction Material and methods Results Comment Acknowledgments References

 
Generation of adenoviral vectors
A replication-incompetent adenoviral vector encoding an ecNOS gene (AdecNOS), driven by the cytomegalovirus promoter, was generated through homologous recombination in 293 cells [17]. The generation, propagation, purification, and evaluation of adenoviral vector containing ecNOS gene have been described in detail previously [18]. Briefly, bovine ecNOS complementary DNA (cDNA) provided by Dr David G Harrison, Emory University, Atlanta, GA) was cloned into the pACCMVpLpA vector (provided by Dr Robert Gerard, University of Texas Southwestern Medical Center, Dallas). The resulting plasmid was linearized with Nru I and cotransfected with dl309 into 293 cells by calcium phosphate/DNA coprecipitation. The recombinant adenovirus encoding an Escherichia coli ß-galactosidase (ß-Gal) reporter gene (AdßGal), used in the experiments as a control vector, was a generous gift of Dr James M Wilson, Institute for Human Gene Therapy, University of Pennsylvania. The viral vector was stored at -70°C in dialysis solution containing 10% glycerol.

Animals
Lewis rats (Harlan Sprague-Daley, Inc, Indianapolis, IN) weighing 220 to 350 g were used in the experiments. Animal care was conducted in accordance with the "Principles of Laboratory Animal Care" formulated by the National Society for Medical Research and the "Guide For the Care and Use of Laboratory Animals" prepared by the National Institutes of Health (NIH publication 86-23, revised 1985).

Experimental groups
The animals were divided into three groups. In the first group (n = 4), donor lungs were transduced before transplantation with 300 µL of AdecNOS at a concentration of 1 x 10⁹ plaque-forming units (pfu)/mL. In the second group (n = 4), donor lungs were transduced before transplantation with 300 µL of AdßGal at a concentration of 1 x 10⁹ pfu/mL. The third group (n = 4; control) consisted of animals that did not undergo operation.

Gene transfer and transplantation
Syngeneic orthotopic single-lung transplantation was performed as previously described [19]. The donor rat was intubated and mechanically ventilated (model 683 Harvard Rodent Ventilator; Harvard Apparatus, Inc, South Natick, MA). A median sternotomy was performed to expose the lungs. After dissection of the hilum, the rat was heparinized with 150 units of aqueous heparin injected into the inferior vena cava. The tidal volume was reduced to 50% and the right bronchus was occluded. The viral solution was instilled in the left bronchus. The lung was ventilated for 5 minutes to allow distribution of the virus. The clamp on the right bronchus was released and the left atrium was opened. Twenty milliliters of pneumoplegia (Euro-Collins’ solution) was infused into the main pulmonary artery, and the heart-lung block was explanted. The lung was stored for 1 hour in Euro-Collins solution at 4°C before implantation to mimic conditions during clinical lung transplantation. In the recipient, a left thoracotomy was performed and the left lung was dissected and removed. The preserved, transduced donor left lung was then implanted orthotopically into the recipient by anastomosing the pulmonary vein and artery. The lung was reperfused, after which the bronchus was anastomosed. All anastomoses were performed with 10-0 monofilament sutures. The chest wall was closed with a small chest tube in situ, which was removed during recovery from anesthesia.

Tissue sampling
Four days after transplantation, native and transplanted lungs, heart, and liver were harvested and tissue sections were snap-frozen in liquid nitrogen. Size- and sex-matched animals that were not operated on (controls) were sacrificed and tissue was collected and analyzed in the same way as in the animals that underwent transplantation.

Polymerase chain reaction
DNA was isolated by standard techniques (DNA STAT-60; TEL-TEST "B", Friendswood, TX). One microgram of total DNA was used in each polymerase chain reaction (PCR), which uses 35 cycles of denaturation (94°C, 30 seconds), annealing (63°C, 30 seconds), and polymerization (72°C, 30 seconds). Primer sequences used for the experiments were as follows: upper 5'AGGCGTCGGTGGGAGGTCTAT, lower 5'GCGCACAGAGTGTCGTAGGTGATG. The upper primer was complementary to the cytomegalovirus promoter. The PCR product amplified is 356 base pairs (bp) in length.

Reverse transcription polymerase chain reaction
Total RNA was extracted from the tissue with RNA STAT-60 reagent (TEL-TEST "B"). Reverse transcription was performed with a SuperScript Preamplification System for First Strand cDNA Synthesis kit (GibcoBRL, Gaithersburg, MD). Total RNA was transcribed to cDNA following the manufacturer’s instruction, using the oligo(dt) priming method. Reverse transcription-generated cDNA encoding for the ecNOS gene was amplified with PCR. Sequences used for the experiments were as follows: upper 5'TCAACCAGTACTACAGCTCC, lower 5'GTGGTTGCAGATGTAGGTGA. These primers are derived from the bovine ecNOS sequence and do not generate a PCR product with the endogenous ecNOS. Primers designed to detect expression of glyceraldehyde 3-phosphate dehydrogenase (G3PDH, Amplimer set; Clontech Laboratories, Inc, Palo Alto, CA) were used to test the efficiency of cDNA synthesis. The PCR product for ecNOS migrates to 250 bp and the G3PDH to 450 bp.

Nitric oxide synthase activity
Nitric oxide synthase activity was determined by measuring the conversion of [³H]-L-arginine to [³H]-L-citrulline by methods originally described by Myatt and associates [20] and modified by Miller and Barber [21]. In brief, tissue homogenates from midsections of the transplanted lungs were prepared and eluted through 10-DG desalting columns. To quantitate NOS activity, duplicate reactions were carried out in the presence of calcium (total activity), in the absence of calcium plus EGTA (calcium-independent activity), and in the absence of calcium plus EGTA in the presence of N^G-monomethyl-L-arginine (L-NMMA; nonspecific activity). Reactions were started by adding 150 µL of protein homogenate to 150 µL of cofactor mix. The reaction was incubated on a shaker at 27°C for 1 hour and terminated by the addition of ice-cold stop buffer. Separation of [³H]-L-arginine from [³H]-L-citrulline was accomplished using affinity columns containing AG 50W-X8 Na⁺ form 200-400 mesh resin (Bio-Rad Laboratories, Hercules, CA). Calcium-dependent activity equals total activity minus calcium-independent activity after correcting for nonspecific activity.

Immunostaining and histologic examination
Midsections of transplanted lungs were embedded in OCT compound (Miles, Elkhart, IN) and quick frozen in a liquid nitrogen-cooled 2-methylbutane bath. Five cryostat sections (5 µm) were cut, fixed for 10 minutes in cold acetone (4°C), fan dried for 10 minutes, and further fixed in 1% paraformaldehyde/EDTA for 3 minutes. After rinsing, endogenous peroxidase activity was blocked by incubating sections in 0.1% sodium azide/0.3% H₂O₂ for 10 minutes. Incubating sections with 5% goat serum/phosphate-buffered saline-Tween 20 blocked nonspecific protein-binding sites. Monoclonal mouse anti-ecNOS (5 µg/mL) (Transduction Laboratories, Lexington, KY) was added to each slide. This antibody does not distinguish endogenous enzyme from the transgene product. Sections were incubated with the antibody for 60 minutes at room temperature. They were then rinsed in tap water and incubated with biotinylated rabbit anti-mouse F(ab')2 (1:300) for 20 minutes. Slides were incubated for 20 minutes with peroxidase-conjugated streptavidin (1:300), followed by incubation for 30 seconds in 0.1 mol/L sodium acetate buffer (pH 5.2). Slides then were placed in AEC (3-amino-9-ethylcarbazole) substrate solution and incubated for 15 minutes at room temperature. After rinsing in tap water, slides were counterstained in mercury-free hematoxylin for 1 minute and further rinsed for 3 minutes in cold running tap water before being mounted.

Adjacent sections were stained with hematoxylin and eosin for routine histopathologic examination. Inflammation was graded by an observer blinded to the origin of the slides, using a modification of a previously reported infection scale for transplanted lungs [22], based on the extent and severity of inflammatory cell infiltration (Table 1).

Statistical analysis
Variance analysis of nonparametric data (Kruskal-Wallis test) followed by Dunn’s multiple range test was used to evaluate differences in calcium-dependent and calcium-independent NOS activity and inflammation scale among the groups. A p value of less than 0.05 was considered significant.

	Results

Top Abstract Introduction Material and methods Results Comment Acknowledgments References

 
Expression of ecNOS in transplanted lungs after gene transfer in vivo
Gene transfer of ecNOS to transplanted lungs was confirmed by PCR. The upper primer was complementary to the cytomegalovirus promoter, and thus allowed differentiation between endogenous NOS and the transferred gene. A 356-bp band was seen only in ecNOS-transduced lungs (Fig 1). Endothelial constitutive NOS DNA was also detected in the contralateral, native lung in one of the ecNOS-transduced animals (data not shown). Hearts and livers of ecNOS-transduced animals did not contain ecNOS transgene. To confirm expression of ecNOS, messenger RNA was analyzed by reverse transcription PCR. Endothelial constitutive NOS RNA (250 bp) was detected in ecNOS-transduced lungs but not in ß-Gal–transduced lungs or unoperated control lungs (Fig 2). The reaction was negative in the absence of reverse transcriptase. Messenger RNA for G3PDH was detected in all samples (450 bp).

View larger version (64K): [in this window] [in a new window]   Fig 1. Polymerase chain reaction of DNA extracted from rat lungs. A 356-bp band for ecNOS DNA is seen only in ecNOS-transduced lungs. (ß-Gal = ß-galactosidase.)

View larger version (68K): [in this window] [in a new window]   Fig 2. Reverse transcriptase polymerase chain reaction of messenger RNA extracted from rat lungs. A 250-bp band for ecNOS messenger RNA is seen only in ecNOS-transduced lungs. Messenger RNA for G3PDH was detected in all samples (450 bp).

View larger version (125K): [in this window] [in a new window]   Fig 3. Immunostaining for ecNOS in ß-galactosidase (ß-Gal)-transduced, transplanted lungs (A) and ecNOS-transduced, transplanted lungs (B). Arrows denote positive staining. Airway epithelium and vascular endothelial cells stained positively for eNOS in lungs from ß-galactosidase–transduced lungs (arrows). Pneumocytes showed positive staining for ecNOS only in ecNOS-transduced lungs (arrow). (x200 before 50% reduction.)

View larger version (13K): [in this window] [in a new window]   Fig 4. Calcium-dependent (Ca Dep; black bars) and calcium-independent (Ca Indep; white bars) nitric oxide synthase activity in nontransfected lungs (CONTROLS) and lungs transfected with ß-galactosidase (ß-GAL) or endothelial nitric oxide synthase (ecNOS). Data are shown as mean ± standard error of the mean, n = 4 in each group. Asterisk denotes statistical significance from control (analysis of variance, p < 0.05).

	Comment

Top Abstract Introduction Material and methods Results Comment Acknowledgments References

 
This study demonstrates transfer of a biologically active gene to transplanted lungs. Transbronchial gene transfer of ecNOS gene resulted in highly efficient transduction of pneumocytes and increased calcium-dependent NOS activity. Endothelial constitutive NOS gene transfer did not increase the inflammatory response in the transplanted lung compared with ß-Gal gene transfer.

Obliterative bronchiolitis after lung transplantation is generally believed to be the end stage of airway injury. The initiating event is thought to be immunologic and stimulated or exacerbated by bacterial and viral infections, or airway ischemia [2–5, 23, 24]. These events may stimulate a common mechanism of injury with the release of inflammatory mediators and growth factors, which results in cell proliferation, fibrous scarring, and luminal obliteration of the terminal airways [5, 23, 24]. Nitric oxide may potentially affect some of the factors involved in the development of OB after lung transplantation. Experimental data indicate that ischemia/reperfusion injury in the lung may be reduced by NO treatment [25]. Nitric oxide can also reduce proliferation of smooth muscle cells, a cell type that may be involved in the pathologic process of OB [5, 23, 24].

Nitric oxide administration by inhalation results in dilation of the pulmonary vasculature. An alternative method to increase NO in lung tissue is the administration of genes encoding for NOS. Gene transfer of type III NOS gene (ecNOS) to the lung increases NO production and reduces acute hypoxia-induced pulmonary hypertension in the normal, nontransplanted rat [10] and can also reduce proliferation of smooth muscle cells in vitro and neointimal hyperplasia after endothelial injury in rat carotid arteries [11, 14]. Therefore, gene transfer of ecNOS has been demonstrated to result in increased NO generation and a beneficial biologic effect.

In the present study, ecNOS gene transfer via the airways resulted in highly efficient gene transfer to the transplanted lung, leading to a 40-fold increase in calcium-dependent NOS activity. However, transduction was restricted mainly to pneumocytes, which may limit the use of transbronchial administration if the disease target is predominantly in the airways. On the other hand, NO is a diffusable molecule, so it may reach the desired cells in the airways even if it is synthesized by adjacent cells. Administration of the vector via the vasculature to the rat appears to be less efficient than airway administration and does not target the airway epithelial cells either [8]. It is possible that the lung ventilation performed after instillation of virus in this study may have decreased contact time of the virus with airway epithelium by displacing the liquid into the lung periphery and that alternate methods may be able to improve delivery of virus to the airway epithelium. Another possible explanation for this specific transfection of the pneumocytes may relate to the distribution of receptors for the adenovirus.

A disadvantage of adenovirus-mediated gene transfer is the potential for induction of an immunologic response to the vector in the transduced organ. The response may cause inflammation and limit the duration of transgene expression [15]. In addition, NO itself may be toxic and has been reported to cause apoptosis in cardiac myocytes [16]. Mild inflammation was observed in both AdecNOS- and ß-Gal–transduced lung transplants. Apoptosis was detected in less than 0.5% of cells in both groups 4 days after transplantation. However, this does not exclude that apoptosis may occur at later time points.

A theoretic possibility exists that adenovirus-mediated gene transfer may result in inducible NOS expression. However, NOS enzymatic activity was nearly abolished by the calcium chelator EGTA, indicating that the enzyme activity was calcium dependent and, therefore, not due to inducible NOS, which is calcium independent.

Transbronchial administration of the vector resulted in transduction of the native lung in 1 animal. This is probably due to back flow of viral solution from the transplanted lung to the native lung when the bronchial clamp was released. Hematogenic distribution of the vector is unlikely as transgene expression was not observed in the heart or in the liver in any animal.

In summary, this study suggests that transbronchial administration of ecNOS gene to the transplanted lung, using an adenoviral vector, results in efficient gene transfer and functional recombinant protein expression. Although mild inflammation was observed in AdecNOS- and AdßGal-transduced transplanted lungs, ecNOS transduction was not associated with apoptosis at the time point tested.

	Acknowledgments

Top Abstract Introduction Material and methods Results Comment Acknowledgments References

 
This work was supported by the Mayo Clinic and Foundation, Rochester, Minnesota, and the Bruce and Ruth Rappaport Program in Vascular Biology. The skillful technical assistance from Sandra Severson and Sharon Guy is gratefully acknowledged. Doctor Anders Jeppsson is a visiting scientist supported by grants from Sahlgrenska University Hospital, University of Gothenburg, The Foundation for Medical Research and Education (SMFS), Assar Gabrielsson Foundation, Gunnar, Arvid and Elisabeth Nilsson Foundation, Swedish Medical Society, Swedish Medical Research Council, and Gothenburg Medical Society.

	References

Top Abstract Introduction Material and methods Results Comment Acknowledgments References

 

1. Hosenpud J.D., Bennett L.E., Keck B.M., Fiol B., Novick R.J. The Registry of the International Society for Heart and Lung Transplantation: fourteenth official report—1997. J Heart Lung Transplant 1997;16:691-712.[Medline]
2. Reichenspurner H., Girgis R.E., Robbins R.C., et al. Obliterative bronchiolitis after lung and heart-lung transplantation. Ann Thorac Surg 1995;60:1845-1853.[Abstract/Free Full Text]
3. Sundaresan S., Trulock E.P., Mohanakumar T., Cooper J.D., Patterson G.A., The Washington University Lung Transplant Group. Prevalence and outcome of bronchiolitis obliterans syndrome after lung transplantation. Ann Thorac Surg 1995;60:1341-1347.[Abstract/Free Full Text]
4. Bando K., Paradis I.L., Similo S., et al. Obliterative bronchiolitis after lung and heart-lung transplantation. J Thorac Cardiovasc Surg 1995;110:4-14.[Abstract/Free Full Text]
5. Mauck K.A., Hosenpud J.D. The bronchial epithelium: a potential allogeneic target for chronic rejection after lung transplantation. J Heart Lung Transplant 1996;15:709-714.[Medline]
6. Jeppsson A., Lee R.J., Pellegrini C., O’Brien T., Tazelaar H.D., McGregor C.G.A. Gene therapy in lung transplantation: effective gene transfer via the airways. J Thorac Cardiovasc Surg 1998;115:638-643.[Abstract/Free Full Text]
7. Chapelier A., Danel C., Mazmanian M., et al. Gene therapy in lung transplantation: feasibility of ex vivo adenovirus-mediated gene transfer to the graft. Hum Gene Ther 1996;7:1837-1845.[Medline]
8. Boasquevisque C.H.R., Mora B.M., Schmid R.A. Ex vivo adenoviral-mediated gene transfer to lung isografts during cold preservation. Ann Thorac Surg 1997;63:1556-1561.[Abstract/Free Full Text]
9. Moncada S., Higgs A. The L-arginine–nitric oxide pathway. N Engl J Med 1993;329:2002-2012.[Free Full Text]
10. Janssens S.P., Bloch K.D., Nong Z., Gerard R.D., Zoldhelyi P., Collen D. Adenoviral-mediated transfer of the human endothelial nitric oxide synthase gene reduces acute hypoxic pulmonary vasoconstriction in rats. J Clin Invest 1996;98:317-324.[Medline]
11. Von der Leyen H.E., Gibbons G.H., Morishita R., et al. Gene therapy inhibiting neointimal vascular lesion: in vivo transfer of endothelial nitric oxide synthase gene. Proc Natl Acad Sci USA 1995;92:1137-1141.[Abstract/Free Full Text]
12. Kullo I.J., Mozes G., Schwartz R.S., et al. Adventitial gene transfer of recombinant endothelial nitric oxide synthase to rabbit carotid arteries alters vascular reactivity. Circulation 1997;96:2254-2261.[Abstract/Free Full Text]
13. Kullo I.J., Mozes G., Schwartz R.S., et al. Enhanced endothelium-dependent relaxations after gene transfer of recombinant endothelial nitric oxide synthase to rabbit carotid arteries. Hypertension 1997;30:314-320.[Abstract/Free Full Text]
14. Kullo I.J., Schwartz R.S., Pompili V.J., et al. Expression and function of recombinant endothelial NO synthase in coronary artery smooth muscle cells. Arterioscler Thromb Vasc Biol 1997;17:2405-2412.[Abstract/Free Full Text]
15. Hullet D.A. Gene therapy in transplantation. J Heart Lung Transplant 1996;15:857-862.[Medline]
16. Kawaguchi H., Shin W.S., Wang Y., et al. In vivo gene transfection of human endothelial cell nitric oxide synthase in cardiomyocytes causes apoptosis-like cell death. Circulation 1997;95:2441-2447.[Abstract/Free Full Text]
17. Spector D.J., Samaniego L.A. Construction and isolation of recombinant adenovirus with gene replacements. Methods Mol Genet 1995;7:31-34.
18. Chen A.F.Y., O’Brien T., Tsutsui M., et al. Expression and function of recombinant endothelial nitric oxide synthase gene in canine basilar artery. Circ Res 1997;80:327-335.[Abstract/Free Full Text]
19. Marck K.W., Wildevuur C.R. Lung transplantation in the rat: I. Technique and survival. Ann Thorac Surg 1982;34:74-80.[Abstract]
20. Myatt L., Brockman D.E., Langdon G., Pollock J.S. Constitutive calcium-dependent isoform of nitric oxide synthase in the human placental villous vascular tree. Placenta 1993;14:373-383.[Medline]
21. Miller V.M., Barber D.A. Modulation of endothelium-derived nitric oxide in canine femoral veins. Am J Physiol 1996;271:H668-H673.
22. Kim H.K., Tazelaar H.D., Odell J., et al. An animal model of pulmonary infection after single lung transplantation. Transplant Proc 1996;28:1816-1817.[Medline]
23. Zeevi A., Dauber J.H., Yousem S.A., et al. Immunologic alterations in chronic lung rejection. In: Shennib H., ed. Immunology of the lung allograft. Austin, TX: R.G. Landes Company, 1995:73-98.
24. Shennib H. Chronic irreversible graft dysfunction (CIGD) and animals models of obliterative bronchiolitis. In: Shennib H., ed. Immunology of the lung allograft. Austin, TX: R.G. Landes Company, 1995:121-134.
25. Fukahara K., Murakami A., Watanabe G., Kotoh K., Misaki T. Inhaled nitric oxide after lung ischemia reperfusion: effect on hemodynamics and oxygen free radical scavenger system. Eur J Cardiothorac Surg 1997;11:343-349.[Abstract]

This article has been cited by other articles:

				H. C. Champion, T. J. Bivalacqua, S. S. Greenberg, T. D. Giles, A. L. Hyman, and P. J. Kadowitz Adenoviral gene transfer of endothelial nitric-oxide synthase (eNOS) partially restores normal pulmonary arterial pressure in eNOS-deficient mice PNAS, October 1, 2002; 99(20): 13248 - 13253. [Abstract] [Full Text] [PDF]

				B. H. Tonnessen, S. R. Severson, R. D. Hurt, and V. M. Miller Modulation of Nitric-Oxide Synthase by Nicotine J. Pharmacol. Exp. Ther., November 1, 2000; 295(2): 601 - 606. [Abstract] [Full Text]

				H. C. Champion, T. J. Bivalacqua, F. M. D'Souza, L. A. Ortiz, J. R. Jeter, K. Toyoda, D. D. Heistad, A. L. Hyman, and P. J. Kadowitz Gene Transfer of Endothelial Nitric Oxide Synthase to the Lung of the Mouse In Vivo : Effect on Agonist-Induced and Flow-Mediated Vascular Responses Circ. Res., June 25, 1999; 84(12): 1422 - 1432. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Add to Personal Folders Download to citation manager Author home page(s): Anders Jeppsson Christopher G.A. McGregor Permission Requests Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Jeppsson, A. Articles by McGregor, C. G.A. Search for Related Content PubMed PubMed Citation Articles by Jeppsson, A. Articles by McGregor, C. G.A.